Incidental Mutation 'R6776:Ttll4'
ID 531272
Institutional Source Beutler Lab
Gene Symbol Ttll4
Ensembl Gene ENSMUSG00000033257
Gene Name tubulin tyrosine ligase-like family, member 4
Synonyms 4632407P03Rik
MMRRC Submission 044892-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.217) question?
Stock # R6776 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 74700804-74740991 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 74720512 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 509 (E509G)
Ref Sequence ENSEMBL: ENSMUSP00000037406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042125] [ENSMUST00000113678] [ENSMUST00000129890] [ENSMUST00000141119]
AlphaFold Q80UG8
Predicted Effect probably damaging
Transcript: ENSMUST00000042125
AA Change: E509G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000037406
Gene: ENSMUSG00000033257
AA Change: E509G

DomainStartEndE-ValueType
low complexity region 504 544 N/A INTRINSIC
Pfam:TTL 645 940 2.2e-106 PFAM
low complexity region 942 961 N/A INTRINSIC
low complexity region 1103 1113 N/A INTRINSIC
low complexity region 1168 1182 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113678
AA Change: E509G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109308
Gene: ENSMUSG00000033257
AA Change: E509G

DomainStartEndE-ValueType
low complexity region 504 544 N/A INTRINSIC
Pfam:TTL 636 876 3.4e-82 PFAM
low complexity region 878 897 N/A INTRINSIC
low complexity region 1039 1049 N/A INTRINSIC
low complexity region 1104 1118 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000129890
AA Change: E74G
SMART Domains Protein: ENSMUSP00000119964
Gene: ENSMUSG00000033257
AA Change: E74G

DomainStartEndE-ValueType
low complexity region 69 101 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000141119
AA Change: E61G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116733
Gene: ENSMUSG00000033257
AA Change: E61G

DomainStartEndE-ValueType
low complexity region 56 96 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 A G 8: 10,038,075 (GRCm39) H224R probably benign Het
Anapc10 T C 8: 80,446,374 (GRCm39) F68S probably damaging Het
Arid2 A G 15: 96,268,830 (GRCm39) N981S probably benign Het
Bmerb1 T A 16: 13,804,670 (GRCm39) S6T possibly damaging Het
Cfap73 A G 5: 120,772,276 (GRCm39) F9L probably damaging Het
Chd3 A C 11: 69,245,296 (GRCm39) L1141V probably damaging Het
Daam1 C T 12: 72,036,582 (GRCm39) L1052F possibly damaging Het
Dmxl1 C T 18: 50,027,041 (GRCm39) R2050C probably damaging Het
Dpp10 G A 1: 123,295,385 (GRCm39) Q552* probably null Het
Dysf A G 6: 84,041,876 (GRCm39) D160G possibly damaging Het
Ecrg4 C A 1: 43,781,551 (GRCm39) N144K probably damaging Het
Firrm T C 1: 163,804,318 (GRCm39) I338M probably damaging Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,052,926 (GRCm39) probably benign Het
Ftcd T C 10: 76,425,073 (GRCm39) I518T probably benign Het
Gapdh A G 6: 125,139,236 (GRCm39) S248P probably damaging Het
Gm5592 C G 7: 40,939,153 (GRCm39) P812A probably damaging Het
Grik2 G A 10: 49,232,085 (GRCm39) L482F probably damaging Het
Gzmg C T 14: 56,394,288 (GRCm39) G202D probably damaging Het
Hectd4 G A 5: 121,491,574 (GRCm39) A3671T possibly damaging Het
Hexa G T 9: 59,465,355 (GRCm39) W203C probably damaging Het
Igdcc4 A T 9: 65,042,700 (GRCm39) T1217S probably benign Het
Ipo7 A G 7: 109,646,272 (GRCm39) D557G probably damaging Het
Irx3 T A 8: 92,526,463 (GRCm39) T414S probably benign Het
Jakmip1 G A 5: 37,344,498 (GRCm39) E1313K probably damaging Het
Kbtbd12 T C 6: 88,595,248 (GRCm39) D194G probably damaging Het
Klk6 T C 7: 43,476,298 (GRCm39) L46P probably damaging Het
Krt86 T C 15: 101,374,817 (GRCm39) I329T probably benign Het
Mroh5 A G 15: 73,661,817 (GRCm39) probably null Het
Mtrf1 T C 14: 79,650,521 (GRCm39) V323A probably damaging Het
Oas3 A T 5: 120,896,939 (GRCm39) I894N probably damaging Het
Oplah C T 15: 76,185,053 (GRCm39) V887I possibly damaging Het
Pag1 T C 3: 9,764,848 (GRCm39) T102A probably benign Het
Pcnx1 C T 12: 82,009,496 (GRCm39) A1181V possibly damaging Het
Pkdrej G T 15: 85,701,510 (GRCm39) Y1475* probably null Het
Pla2g5 A G 4: 138,527,964 (GRCm39) S101P probably benign Het
Plekha4 C A 7: 45,184,241 (GRCm39) A76E probably damaging Het
Plk2 T C 13: 110,536,325 (GRCm39) I592T probably benign Het
Ppp2r3c T A 12: 55,345,252 (GRCm39) R79* probably null Het
Ppp2r3d A T 9: 101,090,061 (GRCm39) H87Q probably benign Het
Prpf40b C T 15: 99,212,784 (GRCm39) R627W probably damaging Het
Prrt4 G T 6: 29,176,551 (GRCm39) T258K possibly damaging Het
Rhpn2 T A 7: 35,083,194 (GRCm39) probably null Het
Slc11a1 T A 1: 74,423,244 (GRCm39) I365N probably damaging Het
Slc7a7 C T 14: 54,612,108 (GRCm39) G265D possibly damaging Het
Thsd7a T A 6: 12,555,636 (GRCm39) T83S possibly damaging Het
Tln2 A G 9: 67,170,187 (GRCm39) S1989P probably damaging Het
Tnfaip3 T G 10: 18,881,324 (GRCm39) T321P probably benign Het
Tnrc6b C T 15: 80,808,320 (GRCm39) P1623L possibly damaging Het
Trpa1 T C 1: 14,982,601 (GRCm39) N85S probably benign Het
Trrap C T 5: 144,788,066 (GRCm39) R3544* probably null Het
Ttf2 A T 3: 100,859,869 (GRCm39) V695E probably benign Het
Vdr T C 15: 97,767,709 (GRCm39) I94V probably damaging Het
Wdfy3 G T 5: 102,031,911 (GRCm39) Q2304K possibly damaging Het
Zfp663 T C 2: 165,200,935 (GRCm39) Y33C probably damaging Het
Other mutations in Ttll4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01606:Ttll4 APN 1 74,725,052 (GRCm39) missense probably damaging 1.00
IGL01743:Ttll4 APN 1 74,727,352 (GRCm39) missense possibly damaging 0.63
IGL01914:Ttll4 APN 1 74,718,217 (GRCm39) missense probably benign 0.01
IGL02288:Ttll4 APN 1 74,718,560 (GRCm39) missense probably benign 0.05
IGL02621:Ttll4 APN 1 74,726,643 (GRCm39) missense probably damaging 1.00
IGL02662:Ttll4 APN 1 74,726,390 (GRCm39) splice site probably null
IGL02890:Ttll4 APN 1 74,726,498 (GRCm39) nonsense probably null
IGL02937:Ttll4 APN 1 74,718,662 (GRCm39) missense possibly damaging 0.92
IGL03178:Ttll4 APN 1 74,719,567 (GRCm39) missense probably damaging 0.96
IGL03412:Ttll4 APN 1 74,726,480 (GRCm39) missense probably benign 0.28
1mM(1):Ttll4 UTSW 1 74,729,139 (GRCm39) missense probably null 1.00
R0083:Ttll4 UTSW 1 74,718,928 (GRCm39) missense probably benign 0.13
R0108:Ttll4 UTSW 1 74,718,928 (GRCm39) missense probably benign 0.13
R0135:Ttll4 UTSW 1 74,719,087 (GRCm39) missense possibly damaging 0.86
R0137:Ttll4 UTSW 1 74,718,851 (GRCm39) missense possibly damaging 0.74
R0306:Ttll4 UTSW 1 74,735,916 (GRCm39) missense probably benign 0.28
R0506:Ttll4 UTSW 1 74,727,777 (GRCm39) missense probably benign 0.06
R0555:Ttll4 UTSW 1 74,727,439 (GRCm39) missense probably damaging 1.00
R1617:Ttll4 UTSW 1 74,718,560 (GRCm39) missense probably benign 0.05
R1649:Ttll4 UTSW 1 74,736,629 (GRCm39) missense possibly damaging 0.52
R1793:Ttll4 UTSW 1 74,726,999 (GRCm39) missense possibly damaging 0.91
R1898:Ttll4 UTSW 1 74,736,641 (GRCm39) missense probably benign 0.01
R1952:Ttll4 UTSW 1 74,726,718 (GRCm39) missense probably damaging 0.99
R1987:Ttll4 UTSW 1 74,724,527 (GRCm39) missense possibly damaging 0.81
R1989:Ttll4 UTSW 1 74,724,527 (GRCm39) missense possibly damaging 0.81
R2067:Ttll4 UTSW 1 74,719,541 (GRCm39) missense possibly damaging 0.94
R2162:Ttll4 UTSW 1 74,725,550 (GRCm39) missense probably damaging 1.00
R2185:Ttll4 UTSW 1 74,718,988 (GRCm39) missense possibly damaging 0.54
R2875:Ttll4 UTSW 1 74,725,597 (GRCm39) splice site probably null
R2876:Ttll4 UTSW 1 74,725,597 (GRCm39) splice site probably null
R2895:Ttll4 UTSW 1 74,724,517 (GRCm39) missense possibly damaging 0.92
R2896:Ttll4 UTSW 1 74,724,517 (GRCm39) missense possibly damaging 0.92
R3157:Ttll4 UTSW 1 74,736,770 (GRCm39) missense possibly damaging 0.81
R3832:Ttll4 UTSW 1 74,725,550 (GRCm39) missense probably damaging 1.00
R4707:Ttll4 UTSW 1 74,718,166 (GRCm39) missense possibly damaging 0.62
R4784:Ttll4 UTSW 1 74,718,166 (GRCm39) missense possibly damaging 0.62
R4785:Ttll4 UTSW 1 74,718,166 (GRCm39) missense possibly damaging 0.62
R5176:Ttll4 UTSW 1 74,718,445 (GRCm39) missense probably damaging 0.99
R5202:Ttll4 UTSW 1 74,727,011 (GRCm39) critical splice donor site probably null
R5244:Ttll4 UTSW 1 74,735,607 (GRCm39) missense probably benign 0.30
R5264:Ttll4 UTSW 1 74,725,535 (GRCm39) missense possibly damaging 0.92
R5452:Ttll4 UTSW 1 74,718,480 (GRCm39) missense probably benign 0.06
R5992:Ttll4 UTSW 1 74,724,550 (GRCm39) missense probably damaging 1.00
R6111:Ttll4 UTSW 1 74,736,698 (GRCm39) missense possibly damaging 0.95
R6722:Ttll4 UTSW 1 74,720,948 (GRCm39) missense possibly damaging 0.95
R6815:Ttll4 UTSW 1 74,718,508 (GRCm39) missense possibly damaging 0.89
R6836:Ttll4 UTSW 1 74,728,572 (GRCm39) missense probably damaging 0.98
R6963:Ttll4 UTSW 1 74,720,975 (GRCm39) missense probably damaging 1.00
R7271:Ttll4 UTSW 1 74,727,820 (GRCm39) missense possibly damaging 0.83
R7508:Ttll4 UTSW 1 74,726,418 (GRCm39) missense possibly damaging 0.81
R7714:Ttll4 UTSW 1 74,718,572 (GRCm39) missense probably benign 0.00
R7837:Ttll4 UTSW 1 74,720,916 (GRCm39) critical splice acceptor site probably null
R8032:Ttll4 UTSW 1 74,735,632 (GRCm39) missense possibly damaging 0.82
R8036:Ttll4 UTSW 1 74,718,389 (GRCm39) missense probably benign 0.02
R8115:Ttll4 UTSW 1 74,726,489 (GRCm39) nonsense probably null
R8949:Ttll4 UTSW 1 74,720,975 (GRCm39) missense probably damaging 0.99
R9145:Ttll4 UTSW 1 74,718,949 (GRCm39) missense probably benign 0.02
R9156:Ttll4 UTSW 1 74,719,225 (GRCm39) missense probably benign 0.00
R9329:Ttll4 UTSW 1 74,725,121 (GRCm39) missense possibly damaging 0.85
R9701:Ttll4 UTSW 1 74,720,482 (GRCm39) missense probably benign 0.07
R9802:Ttll4 UTSW 1 74,720,482 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AGCTGAAGAACTGGCTAGACC -3'
(R):5'- AGGCCCTCAAAACAAATGATGG -3'

Sequencing Primer
(F):5'- AGAACTGGCTAGACCTGGGTTC -3'
(R):5'- GATGCAGGTGATGTCAGTCAAGC -3'
Posted On 2018-08-29