Mutagenetix > Incidental Mutation

Incidental Mutation 'R6776:Ttll4'

531272

Institutional Source

Beutler Lab

Gene Symbol

Ttll4

Ensembl Gene

ENSMUSG00000033257

Gene Name

tubulin tyrosine ligase-like family, member 4

Synonyms

4632407P03Rik

MMRRC Submission

Accession Numbers

Genbank: NM_001014974.1; Ensembl: ENSMUST00000042125

Essential gene?

Probably non essential (E-score: 0.154) question?

Stock #

R6776 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

74661745-74703730 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 74681353 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 509 (E509G)

Ref Sequence

ENSEMBL: ENSMUSP00000037406 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042125] [ENSMUST00000113678] [ENSMUST00000129890] [ENSMUST00000141119]

AlphaFold

Q80UG8

Predicted Effect

probably damaging
Transcript: ENSMUST00000042125
AA Change: E509G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000037406
Gene: ENSMUSG00000033257
AA Change: E509G

Domain	Start	End	E-Value	Type
low complexity region	504	544	N/A	INTRINSIC
Pfam:TTL	645	940	2.2e-106	PFAM
low complexity region	942	961	N/A	INTRINSIC
low complexity region	1103	1113	N/A	INTRINSIC
low complexity region	1168	1182	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000113678
AA Change: E509G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000109308
Gene: ENSMUSG00000033257
AA Change: E509G

Domain	Start	End	E-Value	Type
low complexity region	504	544	N/A	INTRINSIC
Pfam:TTL	636	876	3.4e-82	PFAM
low complexity region	878	897	N/A	INTRINSIC
low complexity region	1039	1049	N/A	INTRINSIC
low complexity region	1104	1118	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000129890
AA Change: E74G

SMART Domains

Protein: ENSMUSP00000119964
Gene: ENSMUSG00000033257
AA Change: E74G

Domain	Start	End	E-Value	Type
low complexity region	69	101	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000141119
AA Change: E61G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000116733
Gene: ENSMUSG00000033257
AA Change: E61G

Domain	Start	End	E-Value	Type
low complexity region	56	96	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.4%

Validation Efficiency

Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1500015O10Rik	C	A	1: 43,742,391	N144K	probably damaging	Het
2900011O08Rik	T	A	16: 13,986,806	S6T	possibly damaging	Het
Abhd13	A	G	8: 9,988,075	H224R	probably benign	Het
Anapc10	T	C	8: 79,719,745	F68S	probably damaging	Het
Arid2	A	G	15: 96,370,949	N981S	probably benign	Het
BC055324	T	C	1: 163,976,749	I338M	probably damaging	Het
Cfap73	A	G	5: 120,634,211	F9L	probably damaging	Het
Chd3	A	C	11: 69,354,470	L1141V	probably damaging	Het
Daam1	C	T	12: 71,989,808	L1052F	possibly damaging	Het
Dmxl1	C	T	18: 49,893,974	R2050C	probably damaging	Het
Dpp10	G	A	1: 123,367,656	Q552*	probably null	Het
Dysf	A	G	6: 84,064,894	D160G	possibly damaging	Het
Foxp1	TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG	TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG	6: 99,075,965		probably benign	Het
Ftcd	T	C	10: 76,589,239	I518T	probably benign	Het
Gapdh	A	G	6: 125,162,273	S248P	probably damaging	Het
Gm5592	C	G	7: 41,289,729	P812A	probably damaging	Het
Grik2	G	A	10: 49,355,989	L482F	probably damaging	Het
Gzmg	C	T	14: 56,156,831	G202D	probably damaging	Het
Hectd4	G	A	5: 121,353,511	A3671T	possibly damaging	Het
Hexa	G	T	9: 59,558,072	W203C	probably damaging	Het
Igdcc4	A	T	9: 65,135,418	T1217S	probably benign	Het
Ipo7	A	G	7: 110,047,065	D557G	probably damaging	Het
Irx3	T	A	8: 91,799,835	T414S	probably benign	Het
Jakmip1	G	A	5: 37,187,154	E1313K	probably damaging	Het
Kbtbd12	T	C	6: 88,618,266	D194G	probably damaging	Het
Klk6	T	C	7: 43,826,874	L46P	probably damaging	Het
Krt86	T	C	15: 101,476,936	I329T	probably benign	Het
Mroh5	A	G	15: 73,789,968		probably null	Het
Mtrf1	T	C	14: 79,413,081	V323A	probably damaging	Het
Oas3	A	T	5: 120,758,874	I894N	probably damaging	Het
Oplah	C	T	15: 76,300,853	V887I	possibly damaging	Het
Pag1	T	C	3: 9,699,788	T102A	probably benign	Het
Pcnx	C	T	12: 81,962,722	A1181V	possibly damaging	Het
Pkdrej	G	T	15: 85,817,309	Y1475*	probably null	Het
Pla2g5	A	G	4: 138,800,653	S101P	probably benign	Het
Plekha4	C	A	7: 45,534,817	A76E	probably damaging	Het
Plk2	T	C	13: 110,399,791	I592T	probably benign	Het
Ppp2r3a	A	T	9: 101,212,862	H87Q	probably benign	Het
Ppp2r3c	T	A	12: 55,298,467	R79*	probably null	Het
Prpf40b	C	T	15: 99,314,903	R627W	probably damaging	Het
Prrt4	G	T	6: 29,176,552	T258K	possibly damaging	Het
Rhpn2	T	A	7: 35,383,769		probably null	Het
Slc11a1	T	A	1: 74,384,085	I365N	probably damaging	Het
Slc7a7	C	T	14: 54,374,651	G265D	possibly damaging	Het
Thsd7a	T	A	6: 12,555,637	T83S	possibly damaging	Het
Tln2	A	G	9: 67,262,905	S1989P	probably damaging	Het
Tnfaip3	T	G	10: 19,005,576	T321P	probably benign	Het
Tnrc6b	C	T	15: 80,924,119	P1623L	possibly damaging	Het
Trpa1	T	C	1: 14,912,377	N85S	probably benign	Het
Trrap	C	T	5: 144,851,256	R3544*	probably null	Het
Ttf2	A	T	3: 100,952,553	V695E	probably benign	Het
Vdr	T	C	15: 97,869,828	I94V	probably damaging	Het
Wdfy3	G	T	5: 101,884,045	Q2304K	possibly damaging	Het
Zfp663	T	C	2: 165,359,015	Y33C	probably damaging	Het

Other mutations in Ttll4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01606:Ttll4	APN	1	74685893	missense	probably damaging	1.00
IGL01743:Ttll4	APN	1	74688193	missense	possibly damaging	0.63
IGL01914:Ttll4	APN	1	74679058	missense	probably benign	0.01
IGL02288:Ttll4	APN	1	74679401	missense	probably benign	0.05
IGL02621:Ttll4	APN	1	74687484	missense	probably damaging	1.00
IGL02662:Ttll4	APN	1	74687231	splice site	probably null
IGL02890:Ttll4	APN	1	74687339	nonsense	probably null
IGL02937:Ttll4	APN	1	74679503	missense	possibly damaging	0.92
IGL03178:Ttll4	APN	1	74680408	missense	probably damaging	0.96
IGL03412:Ttll4	APN	1	74687321	missense	probably benign	0.28
1mM(1):Ttll4	UTSW	1	74689980	missense	probably null	1.00
R0083:Ttll4	UTSW	1	74679769	missense	probably benign	0.13
R0108:Ttll4	UTSW	1	74679769	missense	probably benign	0.13
R0135:Ttll4	UTSW	1	74679928	missense	possibly damaging	0.86
R0137:Ttll4	UTSW	1	74679692	missense	possibly damaging	0.74
R0306:Ttll4	UTSW	1	74696757	missense	probably benign	0.28
R0506:Ttll4	UTSW	1	74688618	missense	probably benign	0.06
R0555:Ttll4	UTSW	1	74688280	missense	probably damaging	1.00
R1617:Ttll4	UTSW	1	74679401	missense	probably benign	0.05
R1649:Ttll4	UTSW	1	74697470	missense	possibly damaging	0.52
R1793:Ttll4	UTSW	1	74687840	missense	possibly damaging	0.91
R1898:Ttll4	UTSW	1	74697482	missense	probably benign	0.01
R1952:Ttll4	UTSW	1	74687559	missense	probably damaging	0.99
R1987:Ttll4	UTSW	1	74685368	missense	possibly damaging	0.81
R1989:Ttll4	UTSW	1	74685368	missense	possibly damaging	0.81
R2067:Ttll4	UTSW	1	74680382	missense	possibly damaging	0.94
R2162:Ttll4	UTSW	1	74686391	missense	probably damaging	1.00
R2185:Ttll4	UTSW	1	74679829	missense	possibly damaging	0.54
R2875:Ttll4	UTSW	1	74686438	splice site	probably null
R2876:Ttll4	UTSW	1	74686438	splice site	probably null
R2895:Ttll4	UTSW	1	74685358	missense	possibly damaging	0.92
R2896:Ttll4	UTSW	1	74685358	missense	possibly damaging	0.92
R3157:Ttll4	UTSW	1	74697611	missense	possibly damaging	0.81
R3832:Ttll4	UTSW	1	74686391	missense	probably damaging	1.00
R4707:Ttll4	UTSW	1	74679007	missense	possibly damaging	0.62
R4784:Ttll4	UTSW	1	74679007	missense	possibly damaging	0.62
R4785:Ttll4	UTSW	1	74679007	missense	possibly damaging	0.62
R5176:Ttll4	UTSW	1	74679286	missense	probably damaging	0.99
R5202:Ttll4	UTSW	1	74687852	critical splice donor site	probably null
R5244:Ttll4	UTSW	1	74696448	missense	probably benign	0.30
R5264:Ttll4	UTSW	1	74686376	missense	possibly damaging	0.92
R5452:Ttll4	UTSW	1	74679321	missense	probably benign	0.06
R5992:Ttll4	UTSW	1	74685391	missense	probably damaging	1.00
R6111:Ttll4	UTSW	1	74697539	missense	possibly damaging	0.95
R6722:Ttll4	UTSW	1	74681789	missense	possibly damaging	0.95
R6815:Ttll4	UTSW	1	74679349	missense	possibly damaging	0.89
R6836:Ttll4	UTSW	1	74689413	missense	probably damaging	0.98
R6963:Ttll4	UTSW	1	74681816	missense	probably damaging	1.00
R7271:Ttll4	UTSW	1	74688661	missense	possibly damaging	0.83
R7508:Ttll4	UTSW	1	74687259	missense	possibly damaging	0.81
R7714:Ttll4	UTSW	1	74679413	missense	probably benign	0.00
R7837:Ttll4	UTSW	1	74681757	critical splice acceptor site	probably null
R8032:Ttll4	UTSW	1	74696473	missense	possibly damaging	0.82
R8036:Ttll4	UTSW	1	74679230	missense	probably benign	0.02
R8115:Ttll4	UTSW	1	74687330	nonsense	probably null
R8949:Ttll4	UTSW	1	74681816	missense	probably damaging	0.99
R9145:Ttll4	UTSW	1	74679790	missense	probably benign	0.02
R9156:Ttll4	UTSW	1	74680066	missense	probably benign	0.00
R9329:Ttll4	UTSW	1	74685962	missense	possibly damaging	0.85
R9701:Ttll4	UTSW	1	74681323	missense	probably benign	0.07
R9802:Ttll4	UTSW	1	74681323	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- AGCTGAAGAACTGGCTAGACC -3'
(R):5'- AGGCCCTCAAAACAAATGATGG -3'

Sequencing Primer
(F):5'- AGAACTGGCTAGACCTGGGTTC -3'
(R):5'- GATGCAGGTGATGTCAGTCAAGC -3'

Posted On

2018-08-29