Incidental Mutation 'R6776:Zfp663'
List |< first << previous [record 55 of 55]
ID531275
Institutional Source Beutler Lab
Gene Symbol Zfp663
Ensembl Gene ENSMUSG00000056824
Gene Namezinc finger protein 663
SynonymsGm1008, LOC381405
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R6776 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location165351297-165368729 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 165359015 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 33 (Y33C)
Ref Sequence ENSEMBL: ENSMUSP00000115254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073062] [ENSMUST00000103085] [ENSMUST00000141140]
Predicted Effect probably damaging
Transcript: ENSMUST00000073062
AA Change: Y33C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072813
Gene: ENSMUSG00000056824
AA Change: Y33C

DomainStartEndE-ValueType
KRAB 8 68 1.97e-31 SMART
ZnF_C2H2 205 227 3.47e1 SMART
ZnF_C2H2 472 494 2.4e-3 SMART
ZnF_C2H2 500 522 2.99e-4 SMART
ZnF_C2H2 528 550 2.43e-4 SMART
ZnF_C2H2 556 578 4.79e-3 SMART
ZnF_C2H2 584 606 3.95e-4 SMART
ZnF_C2H2 612 635 8.6e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103085
AA Change: Y33C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099374
Gene: ENSMUSG00000056824
AA Change: Y33C

DomainStartEndE-ValueType
KRAB 8 68 1.97e-31 SMART
ZnF_C2H2 205 227 3.47e1 SMART
ZnF_C2H2 472 494 2.4e-3 SMART
ZnF_C2H2 500 522 2.99e-4 SMART
ZnF_C2H2 528 550 2.43e-4 SMART
ZnF_C2H2 556 578 4.79e-3 SMART
ZnF_C2H2 584 606 3.95e-4 SMART
ZnF_C2H2 612 635 8.6e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000141140
AA Change: Y33C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115254
Gene: ENSMUSG00000056824
AA Change: Y33C

DomainStartEndE-ValueType
KRAB 8 68 1.97e-31 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik C A 1: 43,742,391 N144K probably damaging Het
2900011O08Rik T A 16: 13,986,806 S6T possibly damaging Het
Abhd13 A G 8: 9,988,075 H224R probably benign Het
Anapc10 T C 8: 79,719,745 F68S probably damaging Het
Arid2 A G 15: 96,370,949 N981S probably benign Het
BC055324 T C 1: 163,976,749 I338M probably damaging Het
Cfap73 A G 5: 120,634,211 F9L probably damaging Het
Chd3 A C 11: 69,354,470 L1141V probably damaging Het
Daam1 C T 12: 71,989,808 L1052F possibly damaging Het
Dmxl1 C T 18: 49,893,974 R2050C probably damaging Het
Dpp10 G A 1: 123,367,656 Q552* probably null Het
Dysf A G 6: 84,064,894 D160G possibly damaging Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,965 probably benign Het
Ftcd T C 10: 76,589,239 I518T probably benign Het
Gapdh A G 6: 125,162,273 S248P probably damaging Het
Gm5592 C G 7: 41,289,729 P812A probably damaging Het
Grik2 G A 10: 49,355,989 L482F probably damaging Het
Gzmg C T 14: 56,156,831 G202D probably damaging Het
Hectd4 G A 5: 121,353,511 A3671T possibly damaging Het
Hexa G T 9: 59,558,072 W203C probably damaging Het
Igdcc4 A T 9: 65,135,418 T1217S probably benign Het
Ipo7 A G 7: 110,047,065 D557G probably damaging Het
Irx3 T A 8: 91,799,835 T414S probably benign Het
Jakmip1 G A 5: 37,187,154 E1313K probably damaging Het
Kbtbd12 T C 6: 88,618,266 D194G probably damaging Het
Klk6 T C 7: 43,826,874 L46P probably damaging Het
Krt86 T C 15: 101,476,936 I329T probably benign Het
Mroh5 A G 15: 73,789,968 probably null Het
Mtrf1 T C 14: 79,413,081 V323A probably damaging Het
Oas3 A T 5: 120,758,874 I894N probably damaging Het
Oplah C T 15: 76,300,853 V887I possibly damaging Het
Pag1 T C 3: 9,699,788 T102A probably benign Het
Pcnx C T 12: 81,962,722 A1181V possibly damaging Het
Pkdrej G T 15: 85,817,309 Y1475* probably null Het
Pla2g5 A G 4: 138,800,653 S101P probably benign Het
Plekha4 C A 7: 45,534,817 A76E probably damaging Het
Plk2 T C 13: 110,399,791 I592T probably benign Het
Ppp2r3a A T 9: 101,212,862 H87Q probably benign Het
Ppp2r3c T A 12: 55,298,467 R79* probably null Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Prrt4 G T 6: 29,176,552 T258K possibly damaging Het
Rhpn2 T A 7: 35,383,769 probably null Het
Slc11a1 T A 1: 74,384,085 I365N probably damaging Het
Slc7a7 C T 14: 54,374,651 G265D possibly damaging Het
Thsd7a T A 6: 12,555,637 T83S possibly damaging Het
Tln2 A G 9: 67,262,905 S1989P probably damaging Het
Tnfaip3 T G 10: 19,005,576 T321P probably benign Het
Tnrc6b C T 15: 80,924,119 P1623L possibly damaging Het
Trpa1 T C 1: 14,912,377 N85S probably benign Het
Trrap C T 5: 144,851,256 R3544* probably null Het
Ttf2 A T 3: 100,952,553 V695E probably benign Het
Ttll4 A G 1: 74,681,353 E509G probably damaging Het
Vdr T C 15: 97,869,828 I94V probably damaging Het
Wdfy3 G T 5: 101,884,045 Q2304K possibly damaging Het
Other mutations in Zfp663
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00720:Zfp663 APN 2 165352605 missense probably damaging 1.00
IGL01382:Zfp663 APN 2 165359015 missense probably damaging 1.00
IGL02007:Zfp663 APN 2 165359073 missense probably benign 0.12
IGL02164:Zfp663 APN 2 165359048 nonsense probably null
IGL02506:Zfp663 APN 2 165353951 missense probably benign 0.35
IGL03173:Zfp663 APN 2 165352499 missense probably damaging 0.99
R0735:Zfp663 UTSW 2 165359075 missense probably damaging 0.97
R1395:Zfp663 UTSW 2 165352572 missense probably damaging 1.00
R1402:Zfp663 UTSW 2 165353970 missense probably benign 0.14
R1402:Zfp663 UTSW 2 165353970 missense probably benign 0.14
R1503:Zfp663 UTSW 2 165352653 missense probably damaging 0.99
R1587:Zfp663 UTSW 2 165353517 missense probably benign
R1854:Zfp663 UTSW 2 165353291 missense probably benign 0.18
R1867:Zfp663 UTSW 2 165352731 missense possibly damaging 0.74
R3031:Zfp663 UTSW 2 165353696 nonsense probably null
R4643:Zfp663 UTSW 2 165353005 missense probably benign 0.24
R4691:Zfp663 UTSW 2 165359130 intron probably benign
R4977:Zfp663 UTSW 2 165353811 missense probably damaging 0.97
R5135:Zfp663 UTSW 2 165353670 missense possibly damaging 0.95
R5151:Zfp663 UTSW 2 165353193 missense probably benign 0.00
R5639:Zfp663 UTSW 2 165353009 missense probably benign 0.03
R5763:Zfp663 UTSW 2 165358435 nonsense probably null
R6929:Zfp663 UTSW 2 165353258 missense probably benign
R6998:Zfp663 UTSW 2 165354002 missense possibly damaging 0.74
R7035:Zfp663 UTSW 2 165353103 missense probably benign 0.36
R7169:Zfp663 UTSW 2 165352439 missense probably benign 0.00
R7529:Zfp663 UTSW 2 165352808 missense probably damaging 1.00
R7790:Zfp663 UTSW 2 165352533 missense probably damaging 1.00
RF004:Zfp663 UTSW 2 165358443 missense probably benign 0.00
Z1177:Zfp663 UTSW 2 165353113 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCTGGTGGGTGACTGCAAAG -3'
(R):5'- CGGATAGGGCAACTCATTCC -3'

Sequencing Primer
(F):5'- CTGCCTCATGTGGTACTGGAAAAC -3'
(R):5'- GATAGGGCAACTCATTCCCTAGCTG -3'
Posted On2018-08-29