Incidental Mutation 'R6776:Ttf2'
List |< first << previous [record 51 of 55] next >> last >|
ID531277
Institutional Source Beutler Lab
Gene Symbol Ttf2
Ensembl Gene ENSMUSG00000033222
Gene Nametranscription termination factor, RNA polymerase II
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R6776 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location100938860-100969663 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100952553 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 695 (V695E)
Ref Sequence ENSEMBL: ENSMUSP00000076208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076941]
Predicted Effect probably benign
Transcript: ENSMUST00000076941
AA Change: V695E

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000076208
Gene: ENSMUSG00000033222
AA Change: V695E

DomainStartEndE-ValueType
Pfam:zf-GRF 4 44 2.3e-10 PFAM
low complexity region 328 340 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
low complexity region 458 479 N/A INTRINSIC
DEXDc 542 774 8.6e-35 SMART
Blast:DEXDc 839 892 8e-7 BLAST
low complexity region 893 909 N/A INTRINSIC
low complexity region 917 932 N/A INTRINSIC
HELICc 999 1082 5.61e-16 SMART
low complexity region 1099 1110 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000151697
AA Change: V18E
SMART Domains Protein: ENSMUSP00000119032
Gene: ENSMUSG00000033222
AA Change: V18E

DomainStartEndE-ValueType
Blast:DEXDc 21 82 1e-20 BLAST
low complexity region 105 121 N/A INTRINSIC
low complexity region 153 168 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SWI2/SNF2 family of proteins, which play a critical role in altering protein-DNA interactions. The encoded protein has been shown to have dsDNA-dependent ATPase activity and RNA polymerase II termination activity. This protein interacts with cell division cycle 5-like, associates with human splicing complexes, and plays a role in pre-mRNA splicing. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik C A 1: 43,742,391 N144K probably damaging Het
2900011O08Rik T A 16: 13,986,806 S6T possibly damaging Het
Abhd13 A G 8: 9,988,075 H224R probably benign Het
Anapc10 T C 8: 79,719,745 F68S probably damaging Het
Arid2 A G 15: 96,370,949 N981S probably benign Het
BC055324 T C 1: 163,976,749 I338M probably damaging Het
Cfap73 A G 5: 120,634,211 F9L probably damaging Het
Chd3 A C 11: 69,354,470 L1141V probably damaging Het
Daam1 C T 12: 71,989,808 L1052F possibly damaging Het
Dmxl1 C T 18: 49,893,974 R2050C probably damaging Het
Dpp10 G A 1: 123,367,656 Q552* probably null Het
Dysf A G 6: 84,064,894 D160G possibly damaging Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,965 probably benign Het
Ftcd T C 10: 76,589,239 I518T probably benign Het
Gapdh A G 6: 125,162,273 S248P probably damaging Het
Gm5592 C G 7: 41,289,729 P812A probably damaging Het
Grik2 G A 10: 49,355,989 L482F probably damaging Het
Gzmg C T 14: 56,156,831 G202D probably damaging Het
Hectd4 G A 5: 121,353,511 A3671T possibly damaging Het
Hexa G T 9: 59,558,072 W203C probably damaging Het
Igdcc4 A T 9: 65,135,418 T1217S probably benign Het
Ipo7 A G 7: 110,047,065 D557G probably damaging Het
Irx3 T A 8: 91,799,835 T414S probably benign Het
Jakmip1 G A 5: 37,187,154 E1313K probably damaging Het
Kbtbd12 T C 6: 88,618,266 D194G probably damaging Het
Klk6 T C 7: 43,826,874 L46P probably damaging Het
Krt86 T C 15: 101,476,936 I329T probably benign Het
Mroh5 A G 15: 73,789,968 probably null Het
Mtrf1 T C 14: 79,413,081 V323A probably damaging Het
Oas3 A T 5: 120,758,874 I894N probably damaging Het
Oplah C T 15: 76,300,853 V887I possibly damaging Het
Pag1 T C 3: 9,699,788 T102A probably benign Het
Pcnx C T 12: 81,962,722 A1181V possibly damaging Het
Pkdrej G T 15: 85,817,309 Y1475* probably null Het
Pla2g5 A G 4: 138,800,653 S101P probably benign Het
Plekha4 C A 7: 45,534,817 A76E probably damaging Het
Plk2 T C 13: 110,399,791 I592T probably benign Het
Ppp2r3a A T 9: 101,212,862 H87Q probably benign Het
Ppp2r3c T A 12: 55,298,467 R79* probably null Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Prrt4 G T 6: 29,176,552 T258K possibly damaging Het
Rhpn2 T A 7: 35,383,769 probably null Het
Slc11a1 T A 1: 74,384,085 I365N probably damaging Het
Slc7a7 C T 14: 54,374,651 G265D possibly damaging Het
Thsd7a T A 6: 12,555,637 T83S possibly damaging Het
Tln2 A G 9: 67,262,905 S1989P probably damaging Het
Tnfaip3 T G 10: 19,005,576 T321P probably benign Het
Tnrc6b C T 15: 80,924,119 P1623L possibly damaging Het
Trpa1 T C 1: 14,912,377 N85S probably benign Het
Trrap C T 5: 144,851,256 R3544* probably null Het
Ttll4 A G 1: 74,681,353 E509G probably damaging Het
Vdr T C 15: 97,869,828 I94V probably damaging Het
Wdfy3 G T 5: 101,884,045 Q2304K possibly damaging Het
Zfp663 T C 2: 165,359,015 Y33C probably damaging Het
Other mutations in Ttf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Ttf2 APN 3 100967097 splice site probably benign
IGL01578:Ttf2 APN 3 100956195 missense possibly damaging 0.59
IGL02218:Ttf2 APN 3 100964093 missense possibly damaging 0.61
IGL03267:Ttf2 APN 3 100944804 nonsense probably null
FR4548:Ttf2 UTSW 3 100963160 small insertion probably benign
FR4737:Ttf2 UTSW 3 100963160 small insertion probably benign
R0784:Ttf2 UTSW 3 100962710 missense probably benign 0.01
R0894:Ttf2 UTSW 3 100969549 splice site probably benign
R2083:Ttf2 UTSW 3 100969501 missense probably benign 0.18
R2125:Ttf2 UTSW 3 100948193 missense possibly damaging 0.93
R2126:Ttf2 UTSW 3 100948193 missense possibly damaging 0.93
R2230:Ttf2 UTSW 3 100957944 missense probably damaging 0.99
R3084:Ttf2 UTSW 3 100948264 missense possibly damaging 0.56
R3700:Ttf2 UTSW 3 100951008 missense probably damaging 1.00
R3963:Ttf2 UTSW 3 100941820 unclassified probably benign
R4002:Ttf2 UTSW 3 100948225 nonsense probably null
R4290:Ttf2 UTSW 3 100962761 missense probably benign 0.01
R4833:Ttf2 UTSW 3 100961406 missense probably benign 0.00
R4909:Ttf2 UTSW 3 100954315 missense probably damaging 1.00
R5011:Ttf2 UTSW 3 100963169 missense probably benign 0.14
R5523:Ttf2 UTSW 3 100959242 missense probably damaging 1.00
R5669:Ttf2 UTSW 3 100951117 nonsense probably null
R6531:Ttf2 UTSW 3 100956260 missense probably damaging 0.99
R6795:Ttf2 UTSW 3 100959262 missense probably damaging 1.00
R6861:Ttf2 UTSW 3 100969625 missense possibly damaging 0.89
R6940:Ttf2 UTSW 3 100969515 missense probably damaging 1.00
R6958:Ttf2 UTSW 3 100945932 missense probably benign 0.30
R6962:Ttf2 UTSW 3 100951137 missense probably damaging 1.00
R7211:Ttf2 UTSW 3 100959307 missense probably benign 0.00
R7365:Ttf2 UTSW 3 100963302 missense possibly damaging 0.92
R7470:Ttf2 UTSW 3 100963162 missense possibly damaging 0.85
R7534:Ttf2 UTSW 3 100950412 intron probably null
R8023:Ttf2 UTSW 3 100956255 missense probably benign 0.01
RF027:Ttf2 UTSW 3 100963157 small insertion probably benign
RF035:Ttf2 UTSW 3 100963157 small insertion probably benign
Z1177:Ttf2 UTSW 3 100959266 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATAGCATGTGAGGCTCTTCGG -3'
(R):5'- AAAGAAGCTGCCTCTGCCAC -3'

Sequencing Primer
(F):5'- TGAGGCTCTTCGGCACTCAAG -3'
(R):5'- TCTGCCACTGCCCCTGG -3'
Posted On2018-08-29