Incidental Mutation 'R6776:Pla2g5'
List |< first << previous [record 35 of 55] next >> last >|
ID531278
Institutional Source Beutler Lab
Gene Symbol Pla2g5
Ensembl Gene ENSMUSG00000041193
Gene Namephospholipase A2, group V
SynonymssPLA2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R6776 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location138799244-138863482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 138800653 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 101 (S101P)
Ref Sequence ENSEMBL: ENSMUSP00000099571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030524] [ENSMUST00000102511] [ENSMUST00000102512] [ENSMUST00000102513]
Predicted Effect probably benign
Transcript: ENSMUST00000030524
AA Change: S101P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000030524
Gene: ENSMUSG00000041193
AA Change: S101P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PA2c 21 137 1.16e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102511
AA Change: S101P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000099569
Gene: ENSMUSG00000041193
AA Change: S101P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PA2c 21 137 1.16e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102512
AA Change: S101P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000099570
Gene: ENSMUSG00000041193
AA Change: S101P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PA2c 21 137 1.16e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102513
AA Change: S101P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000099571
Gene: ENSMUSG00000041193
AA Change: S101P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PA2c 21 137 1.16e-52 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the secretory phospholipase A2 family. It is located in a tightly-linked cluster of secretory phospholipase A2 genes on chromosome 1. The encoded enzyme catalyzes the hydrolysis of membrane phospholipids to generate lysophospholipids and free fatty acids including arachidonic acid. It preferentially hydrolyzes linoleoyl-containing phosphatidylcholine substrates. Secretion of this enzyme is thought to induce inflammatory responses in neighboring cells. Alternatively spliced transcript variants have been found, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display reduced acute zymosan-induced peritonitis and arachadonic acid metabolite release from stimulated peritoneal macrophages. Mice homozygous for a different knock-out allele exhibit reduced response to myocardial ischemia/reperfusion injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik C A 1: 43,742,391 N144K probably damaging Het
2900011O08Rik T A 16: 13,986,806 S6T possibly damaging Het
Abhd13 A G 8: 9,988,075 H224R probably benign Het
Anapc10 T C 8: 79,719,745 F68S probably damaging Het
Arid2 A G 15: 96,370,949 N981S probably benign Het
BC055324 T C 1: 163,976,749 I338M probably damaging Het
Cfap73 A G 5: 120,634,211 F9L probably damaging Het
Chd3 A C 11: 69,354,470 L1141V probably damaging Het
Daam1 C T 12: 71,989,808 L1052F possibly damaging Het
Dmxl1 C T 18: 49,893,974 R2050C probably damaging Het
Dpp10 G A 1: 123,367,656 Q552* probably null Het
Dysf A G 6: 84,064,894 D160G possibly damaging Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,965 probably benign Het
Ftcd T C 10: 76,589,239 I518T probably benign Het
Gapdh A G 6: 125,162,273 S248P probably damaging Het
Gm5592 C G 7: 41,289,729 P812A probably damaging Het
Grik2 G A 10: 49,355,989 L482F probably damaging Het
Gzmg C T 14: 56,156,831 G202D probably damaging Het
Hectd4 G A 5: 121,353,511 A3671T possibly damaging Het
Hexa G T 9: 59,558,072 W203C probably damaging Het
Igdcc4 A T 9: 65,135,418 T1217S probably benign Het
Ipo7 A G 7: 110,047,065 D557G probably damaging Het
Irx3 T A 8: 91,799,835 T414S probably benign Het
Jakmip1 G A 5: 37,187,154 E1313K probably damaging Het
Kbtbd12 T C 6: 88,618,266 D194G probably damaging Het
Klk6 T C 7: 43,826,874 L46P probably damaging Het
Krt86 T C 15: 101,476,936 I329T probably benign Het
Mroh5 A G 15: 73,789,968 probably null Het
Mtrf1 T C 14: 79,413,081 V323A probably damaging Het
Oas3 A T 5: 120,758,874 I894N probably damaging Het
Oplah C T 15: 76,300,853 V887I possibly damaging Het
Pag1 T C 3: 9,699,788 T102A probably benign Het
Pcnx C T 12: 81,962,722 A1181V possibly damaging Het
Pkdrej G T 15: 85,817,309 Y1475* probably null Het
Plekha4 C A 7: 45,534,817 A76E probably damaging Het
Plk2 T C 13: 110,399,791 I592T probably benign Het
Ppp2r3a A T 9: 101,212,862 H87Q probably benign Het
Ppp2r3c T A 12: 55,298,467 R79* probably null Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Prrt4 G T 6: 29,176,552 T258K possibly damaging Het
Rhpn2 T A 7: 35,383,769 probably null Het
Slc11a1 T A 1: 74,384,085 I365N probably damaging Het
Slc7a7 C T 14: 54,374,651 G265D possibly damaging Het
Thsd7a T A 6: 12,555,637 T83S possibly damaging Het
Tln2 A G 9: 67,262,905 S1989P probably damaging Het
Tnfaip3 T G 10: 19,005,576 T321P probably benign Het
Tnrc6b C T 15: 80,924,119 P1623L possibly damaging Het
Trpa1 T C 1: 14,912,377 N85S probably benign Het
Trrap C T 5: 144,851,256 R3544* probably null Het
Ttf2 A T 3: 100,952,553 V695E probably benign Het
Ttll4 A G 1: 74,681,353 E509G probably damaging Het
Vdr T C 15: 97,869,828 I94V probably damaging Het
Wdfy3 G T 5: 101,884,045 Q2304K possibly damaging Het
Zfp663 T C 2: 165,359,015 Y33C probably damaging Het
Other mutations in Pla2g5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03304:Pla2g5 APN 4 138804569 nonsense probably null
R0278:Pla2g5 UTSW 4 138800656 missense probably benign 0.40
R0323:Pla2g5 UTSW 4 138800656 missense probably benign 0.40
R0325:Pla2g5 UTSW 4 138800656 missense probably benign 0.40
R3767:Pla2g5 UTSW 4 138801435 missense probably damaging 1.00
R3768:Pla2g5 UTSW 4 138801435 missense probably damaging 1.00
R3769:Pla2g5 UTSW 4 138801435 missense probably damaging 1.00
R3770:Pla2g5 UTSW 4 138801435 missense probably damaging 1.00
R5620:Pla2g5 UTSW 4 138804610 missense possibly damaging 0.83
R7065:Pla2g5 UTSW 4 138800604 missense probably damaging 1.00
R7097:Pla2g5 UTSW 4 138804519 missense probably damaging 1.00
R7122:Pla2g5 UTSW 4 138804519 missense probably damaging 1.00
R7829:Pla2g5 UTSW 4 138804534 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GAAGGCAGATCCAAGACCTTGTG -3'
(R):5'- TATGGCCCCGATTCAGAGTC -3'

Sequencing Primer
(F):5'- TCCAAGACCTTGTGGGGGAG -3'
(R):5'- GAGTCCTCCTCCACACACTATGAG -3'
Posted On2018-08-29