Incidental Mutation 'R6776:Jakmip1'
List |< first << previous [record 24 of 55] next >> last >|
ID531279
Institutional Source Beutler Lab
Gene Symbol Jakmip1
Ensembl Gene ENSMUSG00000113373
Gene Name
SynonymsGababrbp, C330021K24Rik, Marlin-1, 5830437M04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.629) question?
Stock #R6776 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location37113784-37117473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 37187154 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1313 (E1313K)
Ref Sequence ENSEMBL: ENSMUSP00000147157 (fasta)
Predicted Effect unknown
Transcript: ENSMUST00000207619
AA Change: E187K
Predicted Effect probably damaging
Transcript: ENSMUST00000207866
AA Change: E1313K

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208827
AA Change: E204K

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000232332
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in social deficits, stereotyped activity, abnormal postnatal vocalizations, reduced anxiety/increased impulsivity and glutamatergic NMDAR signaling deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik C A 1: 43,742,391 N144K probably damaging Het
2900011O08Rik T A 16: 13,986,806 S6T possibly damaging Het
Abhd13 A G 8: 9,988,075 H224R probably benign Het
Anapc10 T C 8: 79,719,745 F68S probably damaging Het
Arid2 A G 15: 96,370,949 N981S probably benign Het
BC055324 T C 1: 163,976,749 I338M probably damaging Het
Cfap73 A G 5: 120,634,211 F9L probably damaging Het
Chd3 A C 11: 69,354,470 L1141V probably damaging Het
Daam1 C T 12: 71,989,808 L1052F possibly damaging Het
Dmxl1 C T 18: 49,893,974 R2050C probably damaging Het
Dpp10 G A 1: 123,367,656 Q552* probably null Het
Dysf A G 6: 84,064,894 D160G possibly damaging Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,965 probably benign Het
Ftcd T C 10: 76,589,239 I518T probably benign Het
Gapdh A G 6: 125,162,273 S248P probably damaging Het
Gm5592 C G 7: 41,289,729 P812A probably damaging Het
Grik2 G A 10: 49,355,989 L482F probably damaging Het
Gzmg C T 14: 56,156,831 G202D probably damaging Het
Hectd4 G A 5: 121,353,511 A3671T possibly damaging Het
Hexa G T 9: 59,558,072 W203C probably damaging Het
Igdcc4 A T 9: 65,135,418 T1217S probably benign Het
Ipo7 A G 7: 110,047,065 D557G probably damaging Het
Irx3 T A 8: 91,799,835 T414S probably benign Het
Kbtbd12 T C 6: 88,618,266 D194G probably damaging Het
Klk6 T C 7: 43,826,874 L46P probably damaging Het
Krt86 T C 15: 101,476,936 I329T probably benign Het
Mroh5 A G 15: 73,789,968 probably null Het
Mtrf1 T C 14: 79,413,081 V323A probably damaging Het
Oas3 A T 5: 120,758,874 I894N probably damaging Het
Oplah C T 15: 76,300,853 V887I possibly damaging Het
Pag1 T C 3: 9,699,788 T102A probably benign Het
Pcnx C T 12: 81,962,722 A1181V possibly damaging Het
Pkdrej G T 15: 85,817,309 Y1475* probably null Het
Pla2g5 A G 4: 138,800,653 S101P probably benign Het
Plekha4 C A 7: 45,534,817 A76E probably damaging Het
Plk2 T C 13: 110,399,791 I592T probably benign Het
Ppp2r3a A T 9: 101,212,862 H87Q probably benign Het
Ppp2r3c T A 12: 55,298,467 R79* probably null Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Prrt4 G T 6: 29,176,552 T258K possibly damaging Het
Rhpn2 T A 7: 35,383,769 probably null Het
Slc11a1 T A 1: 74,384,085 I365N probably damaging Het
Slc7a7 C T 14: 54,374,651 G265D possibly damaging Het
Thsd7a T A 6: 12,555,637 T83S possibly damaging Het
Tln2 A G 9: 67,262,905 S1989P probably damaging Het
Tnfaip3 T G 10: 19,005,576 T321P probably benign Het
Tnrc6b C T 15: 80,924,119 P1623L possibly damaging Het
Trpa1 T C 1: 14,912,377 N85S probably benign Het
Trrap C T 5: 144,851,256 R3544* probably null Het
Ttf2 A T 3: 100,952,553 V695E probably benign Het
Ttll4 A G 1: 74,681,353 E509G probably damaging Het
Vdr T C 15: 97,869,828 I94V probably damaging Het
Wdfy3 G T 5: 101,884,045 Q2304K possibly damaging Het
Zfp663 T C 2: 165,359,015 Y33C probably damaging Het
Other mutations in Jakmip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01015:Jakmip1 APN 5 37085406 nonsense probably null
IGL01350:Jakmip1 APN 5 37085431 missense probably benign 0.01
IGL01613:Jakmip1 APN 5 37100768 missense probably damaging 1.00
IGL01875:Jakmip1 APN 5 37120980 missense probably damaging 0.99
IGL02006:Jakmip1 APN 5 37120987 missense probably damaging 0.99
IGL02225:Jakmip1 APN 5 37104856 missense probably damaging 0.99
IGL02389:Jakmip1 APN 5 37100843 nonsense probably null
R0036:Jakmip1 UTSW 5 37134304 missense probably null 0.38
R0194:Jakmip1 UTSW 5 37134283 missense possibly damaging 0.77
R0442:Jakmip1 UTSW 5 37135553 splice site probably null
R0555:Jakmip1 UTSW 5 37118873 missense probably damaging 0.99
R1053:Jakmip1 UTSW 5 37134249 missense possibly damaging 0.59
R1158:Jakmip1 UTSW 5 37091128 missense possibly damaging 0.94
R1470:Jakmip1 UTSW 5 37100838 missense probably damaging 1.00
R1470:Jakmip1 UTSW 5 37100838 missense probably damaging 1.00
R2339:Jakmip1 UTSW 5 37091199 missense probably benign 0.05
R2397:Jakmip1 UTSW 5 37100743 missense probably damaging 0.99
R2425:Jakmip1 UTSW 5 37141805 nonsense probably null
R2973:Jakmip1 UTSW 5 37091527 missense probably damaging 1.00
R4758:Jakmip1 UTSW 5 37128622 missense probably damaging 0.99
R4918:Jakmip1 UTSW 5 37091275 missense probably damaging 1.00
R5212:Jakmip1 UTSW 5 37104901 missense probably benign 0.05
R5842:Jakmip1 UTSW 5 37107268 missense probably damaging 1.00
R5926:Jakmip1 UTSW 5 37085280 unclassified probably benign
R6258:Jakmip1 UTSW 5 37141760 nonsense probably null
R6880:Jakmip1 UTSW 5 37105623 missense possibly damaging 0.95
R6961:Jakmip1 UTSW 5 37173353 missense probably damaging 0.98
R6982:Jakmip1 UTSW 5 37124941 missense probably damaging 1.00
R7109:Jakmip1 UTSW 5 37174765 nonsense probably null
R7173:Jakmip1 UTSW 5 37091364 missense probably damaging 1.00
R7293:Jakmip1 UTSW 5 37127473 missense probably benign 0.00
R7294:Jakmip1 UTSW 5 37117460 missense possibly damaging 0.65
R7361:Jakmip1 UTSW 5 37118804 missense probably damaging 1.00
R7384:Jakmip1 UTSW 5 37173207 missense possibly damaging 0.70
R7454:Jakmip1 UTSW 5 37175154 missense probably damaging 0.96
R7477:Jakmip1 UTSW 5 37173571 missense probably benign 0.00
R7579:Jakmip1 UTSW 5 37127458 missense possibly damaging 0.95
R7617:Jakmip1 UTSW 5 37171001 missense possibly damaging 0.85
R7651:Jakmip1 UTSW 5 37134273 missense probably damaging 0.97
R7702:Jakmip1 UTSW 5 37117497 missense probably damaging 1.00
R7822:Jakmip1 UTSW 5 37175180 missense probably damaging 0.99
R7888:Jakmip1 UTSW 5 37104864 missense probably damaging 1.00
R7971:Jakmip1 UTSW 5 37104864 missense probably damaging 1.00
R8015:Jakmip1 UTSW 5 37159765 missense unknown
R8039:Jakmip1 UTSW 5 37100772 missense probably damaging 1.00
R8044:Jakmip1 UTSW 5 37154644 missense unknown
R8070:Jakmip1 UTSW 5 37173287 missense probably benign 0.10
RF014:Jakmip1 UTSW 5 37174526 missense possibly damaging 0.59
T0722:Jakmip1 UTSW 5 37118903 missense probably damaging 1.00
Z1088:Jakmip1 UTSW 5 37120986 missense probably damaging 1.00
Z1177:Jakmip1 UTSW 5 37091583 missense probably damaging 1.00
Z1177:Jakmip1 UTSW 5 37175307 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTGGAACTTTTAGGATGGTAGCATG -3'
(R):5'- GTCTCCAAGACAGCACATGG -3'

Sequencing Primer
(F):5'- TTAGGATGGTAGCATGTAACCC -3'
(R):5'- CACATGGAAGCAGGTGGCC -3'
Posted On2018-08-29