Incidental Mutation 'R6776:Wdfy3'
ID 531280
Institutional Source Beutler Lab
Gene Symbol Wdfy3
Ensembl Gene ENSMUSG00000043940
Gene Name WD repeat and FYVE domain containing 3
Synonyms D5Ertd66e, Bwf1, Bchs, 2610509D04Rik, Ggtb3
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.938) question?
Stock # R6776 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 101832956-102069921 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 101884045 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 2304 (Q2304K)
Ref Sequence ENSEMBL: ENSMUSP00000134244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053177] [ENSMUST00000174598] [ENSMUST00000212024]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000053177
AA Change: Q2304K

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000052607
Gene: ENSMUSG00000043940
AA Change: Q2304K

DomainStartEndE-ValueType
low complexity region 463 481 N/A INTRINSIC
low complexity region 1408 1417 N/A INTRINSIC
low complexity region 1629 1644 N/A INTRINSIC
Pfam:PH_BEACH 2517 2638 3.1e-17 PFAM
Beach 2677 2958 2.54e-217 SMART
WD40 3054 3088 1.28e1 SMART
WD40 3098 3137 7.73e-6 SMART
WD40 3140 3178 8.29e-1 SMART
WD40 3183 3227 3.09e-1 SMART
low complexity region 3253 3274 N/A INTRINSIC
low complexity region 3307 3318 N/A INTRINSIC
WD40 3381 3420 1.33e1 SMART
FYVE 3428 3497 3.18e-27 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000174598
AA Change: Q2304K

PolyPhen 2 Score 0.571 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134244
Gene: ENSMUSG00000043940
AA Change: Q2304K

DomainStartEndE-ValueType
low complexity region 463 481 N/A INTRINSIC
Pfam:DUF4704 1392 1597 6.6e-11 PFAM
low complexity region 1629 1644 N/A INTRINSIC
Pfam:PH_BEACH 2588 2656 1.8e-14 PFAM
Beach 2695 2976 2.54e-217 SMART
WD40 3072 3106 1.28e1 SMART
WD40 3116 3155 7.73e-6 SMART
WD40 3158 3196 8.29e-1 SMART
WD40 3201 3245 3.09e-1 SMART
low complexity region 3271 3292 N/A INTRINSIC
low complexity region 3325 3336 N/A INTRINSIC
WD40 3399 3438 1.33e1 SMART
FYVE 3446 3515 3.18e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212024
AA Change: Q2290K

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol 3-phosphate-binding protein that functions as a master conductor for aggregate clearance by autophagy. This protein shuttles from the nuclear membrane to colocalize with aggregated proteins, where it complexes with other autophagic components to achieve macroautophagy-mediated clearance of these aggregated proteins. However, it is not necessary for starvation-induced macroautophagy. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for hypomorphic mutations of this gene exhibit perinatal lethality, altered neural progenitor divisions and neuronal migration, a regionally enlarged cerebral cortex, and focal cortical dysplasias. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik C A 1: 43,742,391 N144K probably damaging Het
2900011O08Rik T A 16: 13,986,806 S6T possibly damaging Het
Abhd13 A G 8: 9,988,075 H224R probably benign Het
Anapc10 T C 8: 79,719,745 F68S probably damaging Het
Arid2 A G 15: 96,370,949 N981S probably benign Het
BC055324 T C 1: 163,976,749 I338M probably damaging Het
Cfap73 A G 5: 120,634,211 F9L probably damaging Het
Chd3 A C 11: 69,354,470 L1141V probably damaging Het
Daam1 C T 12: 71,989,808 L1052F possibly damaging Het
Dmxl1 C T 18: 49,893,974 R2050C probably damaging Het
Dpp10 G A 1: 123,367,656 Q552* probably null Het
Dysf A G 6: 84,064,894 D160G possibly damaging Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,965 probably benign Het
Ftcd T C 10: 76,589,239 I518T probably benign Het
Gapdh A G 6: 125,162,273 S248P probably damaging Het
Gm5592 C G 7: 41,289,729 P812A probably damaging Het
Grik2 G A 10: 49,355,989 L482F probably damaging Het
Gzmg C T 14: 56,156,831 G202D probably damaging Het
Hectd4 G A 5: 121,353,511 A3671T possibly damaging Het
Hexa G T 9: 59,558,072 W203C probably damaging Het
Igdcc4 A T 9: 65,135,418 T1217S probably benign Het
Ipo7 A G 7: 110,047,065 D557G probably damaging Het
Irx3 T A 8: 91,799,835 T414S probably benign Het
Jakmip1 G A 5: 37,187,154 E1313K probably damaging Het
Kbtbd12 T C 6: 88,618,266 D194G probably damaging Het
Klk6 T C 7: 43,826,874 L46P probably damaging Het
Krt86 T C 15: 101,476,936 I329T probably benign Het
Mroh5 A G 15: 73,789,968 probably null Het
Mtrf1 T C 14: 79,413,081 V323A probably damaging Het
Oas3 A T 5: 120,758,874 I894N probably damaging Het
Oplah C T 15: 76,300,853 V887I possibly damaging Het
Pag1 T C 3: 9,699,788 T102A probably benign Het
Pcnx C T 12: 81,962,722 A1181V possibly damaging Het
Pkdrej G T 15: 85,817,309 Y1475* probably null Het
Pla2g5 A G 4: 138,800,653 S101P probably benign Het
Plekha4 C A 7: 45,534,817 A76E probably damaging Het
Plk2 T C 13: 110,399,791 I592T probably benign Het
Ppp2r3a A T 9: 101,212,862 H87Q probably benign Het
Ppp2r3c T A 12: 55,298,467 R79* probably null Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Prrt4 G T 6: 29,176,552 T258K possibly damaging Het
Rhpn2 T A 7: 35,383,769 probably null Het
Slc11a1 T A 1: 74,384,085 I365N probably damaging Het
Slc7a7 C T 14: 54,374,651 G265D possibly damaging Het
Thsd7a T A 6: 12,555,637 T83S possibly damaging Het
Tln2 A G 9: 67,262,905 S1989P probably damaging Het
Tnfaip3 T G 10: 19,005,576 T321P probably benign Het
Tnrc6b C T 15: 80,924,119 P1623L possibly damaging Het
Trpa1 T C 1: 14,912,377 N85S probably benign Het
Trrap C T 5: 144,851,256 R3544* probably null Het
Ttf2 A T 3: 100,952,553 V695E probably benign Het
Ttll4 A G 1: 74,681,353 E509G probably damaging Het
Vdr T C 15: 97,869,828 I94V probably damaging Het
Zfp663 T C 2: 165,359,015 Y33C probably damaging Het
Other mutations in Wdfy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Wdfy3 APN 5 101915338 critical splice donor site probably null
IGL00567:Wdfy3 APN 5 101912030 splice site probably benign
IGL01288:Wdfy3 APN 5 101901991 splice site probably null
IGL01323:Wdfy3 APN 5 101895064 missense probably damaging 1.00
IGL01352:Wdfy3 APN 5 101944120 missense probably damaging 1.00
IGL01553:Wdfy3 APN 5 101900031 missense probably benign
IGL01560:Wdfy3 APN 5 101957486 nonsense probably null
IGL01566:Wdfy3 APN 5 101896588 splice site probably benign
IGL01616:Wdfy3 APN 5 101913260 missense probably damaging 0.97
IGL01630:Wdfy3 APN 5 101907488 missense probably benign
IGL01791:Wdfy3 APN 5 101937412 missense probably damaging 1.00
IGL01820:Wdfy3 APN 5 101924081 missense probably benign 0.11
IGL01953:Wdfy3 APN 5 101895028 nonsense probably null
IGL02121:Wdfy3 APN 5 101898510 missense possibly damaging 0.85
IGL02167:Wdfy3 APN 5 101961157 missense probably damaging 0.98
IGL02321:Wdfy3 APN 5 101922609 missense probably damaging 0.99
IGL02327:Wdfy3 APN 5 101888192 missense probably damaging 1.00
IGL02651:Wdfy3 APN 5 101896475 missense probably benign 0.37
IGL02801:Wdfy3 APN 5 101907587 missense probably damaging 1.00
IGL02839:Wdfy3 APN 5 101968920 missense probably damaging 1.00
IGL02870:Wdfy3 APN 5 101855471 missense probably damaging 1.00
IGL02997:Wdfy3 APN 5 101894912 missense probably null 1.00
IGL03064:Wdfy3 APN 5 101935997 missense probably damaging 0.99
IGL03090:Wdfy3 APN 5 101866276 missense probably damaging 1.00
IGL03211:Wdfy3 APN 5 101844912 splice site probably benign
IGL03237:Wdfy3 APN 5 101844599 missense probably damaging 1.00
IGL03264:Wdfy3 APN 5 101900150 missense probably damaging 1.00
Esurient UTSW 5 101944103 missense probably damaging 1.00
IGL02988:Wdfy3 UTSW 5 101929981 missense probably damaging 0.99
PIT4382001:Wdfy3 UTSW 5 101882961 frame shift probably null
R0010:Wdfy3 UTSW 5 101848349 missense probably damaging 1.00
R0010:Wdfy3 UTSW 5 101848349 missense probably damaging 1.00
R0025:Wdfy3 UTSW 5 101845046 missense probably damaging 0.98
R0031:Wdfy3 UTSW 5 101889295 missense probably damaging 0.97
R0047:Wdfy3 UTSW 5 101944033 missense probably damaging 1.00
R0047:Wdfy3 UTSW 5 101944033 missense probably damaging 1.00
R0053:Wdfy3 UTSW 5 101844614 missense probably damaging 0.97
R0078:Wdfy3 UTSW 5 101888105 missense possibly damaging 0.57
R0147:Wdfy3 UTSW 5 101917411 missense probably benign 0.05
R0148:Wdfy3 UTSW 5 101917411 missense probably benign 0.05
R0279:Wdfy3 UTSW 5 101868092 missense probably damaging 1.00
R0380:Wdfy3 UTSW 5 101948966 missense probably damaging 0.99
R0472:Wdfy3 UTSW 5 101957443 missense probably benign 0.13
R0513:Wdfy3 UTSW 5 101890789 missense probably damaging 0.96
R0594:Wdfy3 UTSW 5 101906185 missense possibly damaging 0.94
R0601:Wdfy3 UTSW 5 101836172 missense probably benign
R0787:Wdfy3 UTSW 5 101957388 missense probably damaging 1.00
R0825:Wdfy3 UTSW 5 101870051 missense probably damaging 1.00
R1122:Wdfy3 UTSW 5 101882966 missense possibly damaging 0.94
R1167:Wdfy3 UTSW 5 101875931 missense probably benign
R1350:Wdfy3 UTSW 5 101898552 missense probably damaging 1.00
R1422:Wdfy3 UTSW 5 101884214 splice site probably benign
R1446:Wdfy3 UTSW 5 101851310 missense possibly damaging 0.68
R1452:Wdfy3 UTSW 5 101937738 missense possibly damaging 0.91
R1457:Wdfy3 UTSW 5 101917579 missense possibly damaging 0.57
R1543:Wdfy3 UTSW 5 101844081 missense probably benign
R1633:Wdfy3 UTSW 5 101981548 missense probably damaging 1.00
R1643:Wdfy3 UTSW 5 101875915 missense possibly damaging 0.62
R1656:Wdfy3 UTSW 5 101941447 missense probably damaging 1.00
R1720:Wdfy3 UTSW 5 101926525 frame shift probably null
R1743:Wdfy3 UTSW 5 101844065 missense probably benign 0.12
R1745:Wdfy3 UTSW 5 101948929 missense probably damaging 0.96
R1850:Wdfy3 UTSW 5 101894999 missense probably damaging 1.00
R1852:Wdfy3 UTSW 5 101915376 missense probably benign 0.00
R1854:Wdfy3 UTSW 5 101888186 missense probably benign 0.05
R1880:Wdfy3 UTSW 5 101917435 missense probably benign 0.05
R1930:Wdfy3 UTSW 5 101941492 missense probably damaging 1.00
R1931:Wdfy3 UTSW 5 101941492 missense probably damaging 1.00
R1956:Wdfy3 UTSW 5 101919409 missense probably benign 0.30
R1965:Wdfy3 UTSW 5 101951312 missense probably damaging 1.00
R1997:Wdfy3 UTSW 5 101968946 missense probably damaging 1.00
R2015:Wdfy3 UTSW 5 101860486 missense probably null 1.00
R2087:Wdfy3 UTSW 5 101895060 missense probably damaging 1.00
R2156:Wdfy3 UTSW 5 101898425 critical splice donor site probably null
R2192:Wdfy3 UTSW 5 101907542 missense possibly damaging 0.55
R2313:Wdfy3 UTSW 5 101889284 missense probably damaging 1.00
R2332:Wdfy3 UTSW 5 101888323 splice site probably benign
R2406:Wdfy3 UTSW 5 101888259 missense probably damaging 1.00
R2679:Wdfy3 UTSW 5 101870036 missense probably damaging 1.00
R2857:Wdfy3 UTSW 5 101875930 missense probably benign 0.04
R2937:Wdfy3 UTSW 5 101944122 missense probably benign 0.07
R3765:Wdfy3 UTSW 5 101861400 missense probably damaging 1.00
R3795:Wdfy3 UTSW 5 101937600 missense probably damaging 1.00
R3937:Wdfy3 UTSW 5 101944239 nonsense probably null
R3947:Wdfy3 UTSW 5 101870036 missense probably damaging 1.00
R4024:Wdfy3 UTSW 5 101924095 splice site probably benign
R4065:Wdfy3 UTSW 5 101922447 missense probably benign 0.08
R4066:Wdfy3 UTSW 5 101922447 missense probably benign 0.08
R4110:Wdfy3 UTSW 5 101900058 critical splice donor site probably null
R4235:Wdfy3 UTSW 5 101922634 critical splice acceptor site probably null
R4420:Wdfy3 UTSW 5 101910984 missense probably damaging 0.97
R4620:Wdfy3 UTSW 5 101906145 missense probably damaging 0.99
R4624:Wdfy3 UTSW 5 101884083 missense possibly damaging 0.52
R4626:Wdfy3 UTSW 5 101943934 missense probably damaging 1.00
R4727:Wdfy3 UTSW 5 101930028 missense probably damaging 0.99
R4794:Wdfy3 UTSW 5 101943943 missense probably damaging 1.00
R4869:Wdfy3 UTSW 5 101894921 missense probably damaging 0.98
R4971:Wdfy3 UTSW 5 101948972 nonsense probably null
R4973:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R4976:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R4984:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R4986:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R5068:Wdfy3 UTSW 5 101894937 missense probably benign 0.15
R5105:Wdfy3 UTSW 5 101855549 missense probably damaging 1.00
R5120:Wdfy3 UTSW 5 101868106 missense possibly damaging 0.85
R5134:Wdfy3 UTSW 5 101944103 missense probably damaging 1.00
R5139:Wdfy3 UTSW 5 101849267 critical splice donor site probably null
R5235:Wdfy3 UTSW 5 101847106 missense probably null 0.03
R5303:Wdfy3 UTSW 5 101952983 missense probably damaging 1.00
R5368:Wdfy3 UTSW 5 101872858 missense probably damaging 1.00
R5426:Wdfy3 UTSW 5 101919446 missense probably damaging 0.97
R5442:Wdfy3 UTSW 5 101896559 missense probably benign 0.04
R5487:Wdfy3 UTSW 5 101836274 missense probably damaging 1.00
R5509:Wdfy3 UTSW 5 101861448 missense possibly damaging 0.69
R5877:Wdfy3 UTSW 5 101869989 missense probably damaging 1.00
R5988:Wdfy3 UTSW 5 101884138 missense probably benign 0.00
R6017:Wdfy3 UTSW 5 101851359 missense probably benign 0.01
R6019:Wdfy3 UTSW 5 101849423 missense probably damaging 1.00
R6199:Wdfy3 UTSW 5 101872965 missense possibly damaging 0.93
R6228:Wdfy3 UTSW 5 101898429 missense possibly damaging 0.67
R6258:Wdfy3 UTSW 5 101872965 missense possibly damaging 0.93
R6259:Wdfy3 UTSW 5 101872965 missense possibly damaging 0.93
R6298:Wdfy3 UTSW 5 101968946 missense probably damaging 1.00
R6479:Wdfy3 UTSW 5 101913179 missense probably damaging 1.00
R6550:Wdfy3 UTSW 5 101953166 missense probably benign 0.19
R6793:Wdfy3 UTSW 5 101917431 nonsense probably null
R6809:Wdfy3 UTSW 5 101923947 missense possibly damaging 0.63
R6836:Wdfy3 UTSW 5 101952999 missense probably damaging 1.00
R6897:Wdfy3 UTSW 5 101844066 missense probably benign 0.10
R7014:Wdfy3 UTSW 5 101894909 critical splice donor site probably null
R7034:Wdfy3 UTSW 5 101907518 missense probably damaging 1.00
R7035:Wdfy3 UTSW 5 101855549 missense probably damaging 1.00
R7135:Wdfy3 UTSW 5 101915437 missense probably damaging 1.00
R7182:Wdfy3 UTSW 5 101943892 missense possibly damaging 0.51
R7217:Wdfy3 UTSW 5 101901919 missense probably damaging 1.00
R7236:Wdfy3 UTSW 5 101836208 missense probably damaging 0.99
R7264:Wdfy3 UTSW 5 101855523 missense probably benign 0.02
R7418:Wdfy3 UTSW 5 101957500 missense probably benign 0.08
R7533:Wdfy3 UTSW 5 101882488 missense probably benign 0.27
R7543:Wdfy3 UTSW 5 101936059 missense probably benign 0.00
R7625:Wdfy3 UTSW 5 101855386 splice site probably null
R7788:Wdfy3 UTSW 5 101848357 missense probably damaging 0.99
R7810:Wdfy3 UTSW 5 101895074 missense probably benign 0.01
R7810:Wdfy3 UTSW 5 101951399 nonsense probably null
R8204:Wdfy3 UTSW 5 101852585 missense probably benign 0.00
R8268:Wdfy3 UTSW 5 101941610 missense probably damaging 1.00
R8286:Wdfy3 UTSW 5 101937421 missense probably benign
R8507:Wdfy3 UTSW 5 101872901 missense probably benign 0.05
R8514:Wdfy3 UTSW 5 101851353 missense possibly damaging 0.92
R8536:Wdfy3 UTSW 5 101885198 missense probably benign
R8710:Wdfy3 UTSW 5 101882483 missense probably damaging 1.00
R8735:Wdfy3 UTSW 5 101930085 missense probably benign 0.00
R8749:Wdfy3 UTSW 5 101882580 missense probably damaging 1.00
R8931:Wdfy3 UTSW 5 101917555 missense probably benign 0.11
R8943:Wdfy3 UTSW 5 101845365 intron probably benign
R8968:Wdfy3 UTSW 5 101864117 missense probably benign 0.05
R8979:Wdfy3 UTSW 5 101948898 missense probably damaging 1.00
R8998:Wdfy3 UTSW 5 101845192 missense probably benign 0.05
R9045:Wdfy3 UTSW 5 101847174 missense probably damaging 1.00
R9068:Wdfy3 UTSW 5 101852585 missense probably benign 0.34
R9105:Wdfy3 UTSW 5 101882646 missense probably benign 0.05
R9122:Wdfy3 UTSW 5 101943965 missense probably damaging 1.00
R9209:Wdfy3 UTSW 5 101930964 missense probably benign 0.01
R9249:Wdfy3 UTSW 5 101848493 missense possibly damaging 0.82
R9348:Wdfy3 UTSW 5 101941492 missense probably damaging 1.00
R9481:Wdfy3 UTSW 5 101852612 missense probably benign 0.19
R9490:Wdfy3 UTSW 5 101930850 missense probably benign 0.29
R9524:Wdfy3 UTSW 5 101907467 missense probably benign 0.03
R9545:Wdfy3 UTSW 5 101953091 missense
R9548:Wdfy3 UTSW 5 101885193 missense probably damaging 0.99
R9636:Wdfy3 UTSW 5 101900033 missense probably benign
R9750:Wdfy3 UTSW 5 101930094 missense probably benign 0.00
R9766:Wdfy3 UTSW 5 101895000 missense possibly damaging 0.90
R9771:Wdfy3 UTSW 5 101852329 missense probably damaging 1.00
Z1177:Wdfy3 UTSW 5 101900241 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- ATGAGTCAGGTATACACGCCC -3'
(R):5'- TGATTTTAAACTTACAGCCCACGAG -3'

Sequencing Primer
(F):5'- GGAAGACACTCTGGAACCTGC -3'
(R):5'- TTACAGCCCACGAGAAGAAATG -3'
Posted On 2018-08-29