Incidental Mutation 'R6776:Klk6'
List |< first << previous [record 26 of 55] next >> last >|
ID531293
Institutional Source Beutler Lab
Gene Symbol Klk6
Ensembl Gene ENSMUSG00000050063
Gene Namekallikrein related-peptidase 6
SynonymsBssp, Klk29, neurosin, protease M, Prss18, Prss9
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6776 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location43824499-43832030 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43826874 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 46 (L46P)
Ref Sequence ENSEMBL: ENSMUSP00000135591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107966] [ENSMUST00000107967] [ENSMUST00000107968] [ENSMUST00000177514]
Predicted Effect probably damaging
Transcript: ENSMUST00000107966
AA Change: L46P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103600
Gene: ENSMUSG00000050063
AA Change: L46P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 28 244 3.1e-89 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107967
AA Change: L46P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103601
Gene: ENSMUSG00000050063
AA Change: L46P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 28 244 3.1e-89 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107968
AA Change: L46P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103602
Gene: ENSMUSG00000050063
AA Change: L46P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 28 244 3.1e-89 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177514
AA Change: L46P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135591
Gene: ENSMUSG00000050063
AA Change: L46P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 28 129 5.07e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kallikrein subfamily of the peptidase S1 family of serine proteases. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. The encoded preproprotein is proteolytically processed to generate the mature protease. Expression of this protease is regulated by steroid hormones and may be elevated in multiple human cancers and in serum from psoriasis patients. The encoded protease may participate in the cleavage of amyloid precursor protein and alpha-synuclein, thus implicating this protease in Alzheimer's and Parkinson's disease, respectively. This gene is located in a gene cluster on chromosome 19. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased mature oligodendrocytes in the developing spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik C A 1: 43,742,391 N144K probably damaging Het
2900011O08Rik T A 16: 13,986,806 S6T possibly damaging Het
Abhd13 A G 8: 9,988,075 H224R probably benign Het
Anapc10 T C 8: 79,719,745 F68S probably damaging Het
Arid2 A G 15: 96,370,949 N981S probably benign Het
BC055324 T C 1: 163,976,749 I338M probably damaging Het
Cfap73 A G 5: 120,634,211 F9L probably damaging Het
Chd3 A C 11: 69,354,470 L1141V probably damaging Het
Daam1 C T 12: 71,989,808 L1052F possibly damaging Het
Dmxl1 C T 18: 49,893,974 R2050C probably damaging Het
Dpp10 G A 1: 123,367,656 Q552* probably null Het
Dysf A G 6: 84,064,894 D160G possibly damaging Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,965 probably benign Het
Ftcd T C 10: 76,589,239 I518T probably benign Het
Gapdh A G 6: 125,162,273 S248P probably damaging Het
Gm5592 C G 7: 41,289,729 P812A probably damaging Het
Grik2 G A 10: 49,355,989 L482F probably damaging Het
Gzmg C T 14: 56,156,831 G202D probably damaging Het
Hectd4 G A 5: 121,353,511 A3671T possibly damaging Het
Hexa G T 9: 59,558,072 W203C probably damaging Het
Igdcc4 A T 9: 65,135,418 T1217S probably benign Het
Ipo7 A G 7: 110,047,065 D557G probably damaging Het
Irx3 T A 8: 91,799,835 T414S probably benign Het
Jakmip1 G A 5: 37,187,154 E1313K probably damaging Het
Kbtbd12 T C 6: 88,618,266 D194G probably damaging Het
Krt86 T C 15: 101,476,936 I329T probably benign Het
Mroh5 A G 15: 73,789,968 probably null Het
Mtrf1 T C 14: 79,413,081 V323A probably damaging Het
Oas3 A T 5: 120,758,874 I894N probably damaging Het
Oplah C T 15: 76,300,853 V887I possibly damaging Het
Pag1 T C 3: 9,699,788 T102A probably benign Het
Pcnx C T 12: 81,962,722 A1181V possibly damaging Het
Pkdrej G T 15: 85,817,309 Y1475* probably null Het
Pla2g5 A G 4: 138,800,653 S101P probably benign Het
Plekha4 C A 7: 45,534,817 A76E probably damaging Het
Plk2 T C 13: 110,399,791 I592T probably benign Het
Ppp2r3a A T 9: 101,212,862 H87Q probably benign Het
Ppp2r3c T A 12: 55,298,467 R79* probably null Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Prrt4 G T 6: 29,176,552 T258K possibly damaging Het
Rhpn2 T A 7: 35,383,769 probably null Het
Slc11a1 T A 1: 74,384,085 I365N probably damaging Het
Slc7a7 C T 14: 54,374,651 G265D possibly damaging Het
Thsd7a T A 6: 12,555,637 T83S possibly damaging Het
Tln2 A G 9: 67,262,905 S1989P probably damaging Het
Tnfaip3 T G 10: 19,005,576 T321P probably benign Het
Tnrc6b C T 15: 80,924,119 P1623L possibly damaging Het
Trpa1 T C 1: 14,912,377 N85S probably benign Het
Trrap C T 5: 144,851,256 R3544* probably null Het
Ttf2 A T 3: 100,952,553 V695E probably benign Het
Ttll4 A G 1: 74,681,353 E509G probably damaging Het
Vdr T C 15: 97,869,828 I94V probably damaging Het
Wdfy3 G T 5: 101,884,045 Q2304K possibly damaging Het
Zfp663 T C 2: 165,359,015 Y33C probably damaging Het
Other mutations in Klk6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02691:Klk6 APN 7 43828500 missense probably benign 0.03
R0382:Klk6 UTSW 7 43829245 missense probably benign 0.03
R0453:Klk6 UTSW 7 43828539 missense probably damaging 1.00
R1479:Klk6 UTSW 7 43831634 missense probably benign 0.03
R1521:Klk6 UTSW 7 43829275 critical splice donor site probably null
R1772:Klk6 UTSW 7 43829271 nonsense probably null
R1902:Klk6 UTSW 7 43826057 start codon destroyed probably benign 0.03
R4238:Klk6 UTSW 7 43829173 missense probably benign 0.02
R4239:Klk6 UTSW 7 43829173 missense probably benign 0.02
R4240:Klk6 UTSW 7 43829173 missense probably benign 0.02
R5182:Klk6 UTSW 7 43828660 missense probably benign 0.16
R5274:Klk6 UTSW 7 43829129 splice site probably null
R7411:Klk6 UTSW 7 43826943 missense probably damaging 1.00
R7702:Klk6 UTSW 7 43829265 missense probably damaging 0.98
R8035:Klk6 UTSW 7 43828662 missense probably benign 0.00
Z1088:Klk6 UTSW 7 43828488 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TAAAGCGTGCTTACGTCTTTG -3'
(R):5'- TGATGGATGCTCAGGTCTGC -3'

Sequencing Primer
(F):5'- AGATGGCTCAGATGACTGCTC -3'
(R):5'- AGTCTACAAGGCACCCTT -3'
Posted On2018-08-29