Incidental Mutation 'R6776:Ppp2r3c'
ID531307
Institutional Source Beutler Lab
Gene Symbol Ppp2r3c
Ensembl Gene ENSMUSG00000021022
Gene Nameprotein phosphatase 2, regulatory subunit B'', gamma
Synonyms4930511A21Rik, G5pr, G4-1, 5730412A08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R6776 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location55278991-55302998 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 55298467 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 79 (R79*)
Ref Sequence ENSEMBL: ENSMUSP00000021410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021410] [ENSMUST00000021411] [ENSMUST00000183475] [ENSMUST00000183654] [ENSMUST00000184766] [ENSMUST00000184980]
Predicted Effect probably null
Transcript: ENSMUST00000021410
AA Change: R79*
SMART Domains Protein: ENSMUSP00000021410
Gene: ENSMUSG00000021022
AA Change: R79*

DomainStartEndE-ValueType
PDB:4I5K|B 188 437 1e-25 PDB
SCOP:d1dgua_ 258 413 4e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021411
SMART Domains Protein: ENSMUSP00000021411
Gene: ENSMUSG00000021023

DomainStartEndE-ValueType
Pfam:PRORP 339 575 4.8e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183475
SMART Domains Protein: ENSMUSP00000139252
Gene: ENSMUSG00000021023

DomainStartEndE-ValueType
low complexity region 410 424 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183654
SMART Domains Protein: ENSMUSP00000138821
Gene: ENSMUSG00000021023

DomainStartEndE-ValueType
Pfam:RNase_Zc3h12a 33 185 8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184766
SMART Domains Protein: ENSMUSP00000139204
Gene: ENSMUSG00000021023

DomainStartEndE-ValueType
PDB:4G26|A 153 581 1e-9 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000184980
SMART Domains Protein: ENSMUSP00000139123
Gene: ENSMUSG00000021023

DomainStartEndE-ValueType
low complexity region 113 127 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulatory subunit of the serine/threonine phosphatase, protein phosphatase 2. This protein is localized to both nuclear and cytoplasmic regions depending on cell cycle phase. Homozygous conditional knockout mice for this gene exhibit reduced numbers and impaired proliferation of immune system B cells. This protein may regulate the expression of the P-glycoprotein ATP-binding cassette transporter through its phosphatase activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik C A 1: 43,742,391 N144K probably damaging Het
2900011O08Rik T A 16: 13,986,806 S6T possibly damaging Het
Abhd13 A G 8: 9,988,075 H224R probably benign Het
Anapc10 T C 8: 79,719,745 F68S probably damaging Het
Arid2 A G 15: 96,370,949 N981S probably benign Het
BC055324 T C 1: 163,976,749 I338M probably damaging Het
Cfap73 A G 5: 120,634,211 F9L probably damaging Het
Chd3 A C 11: 69,354,470 L1141V probably damaging Het
Daam1 C T 12: 71,989,808 L1052F possibly damaging Het
Dmxl1 C T 18: 49,893,974 R2050C probably damaging Het
Dpp10 G A 1: 123,367,656 Q552* probably null Het
Dysf A G 6: 84,064,894 D160G possibly damaging Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,965 probably benign Het
Ftcd T C 10: 76,589,239 I518T probably benign Het
Gapdh A G 6: 125,162,273 S248P probably damaging Het
Gm5592 C G 7: 41,289,729 P812A probably damaging Het
Grik2 G A 10: 49,355,989 L482F probably damaging Het
Gzmg C T 14: 56,156,831 G202D probably damaging Het
Hectd4 G A 5: 121,353,511 A3671T possibly damaging Het
Hexa G T 9: 59,558,072 W203C probably damaging Het
Igdcc4 A T 9: 65,135,418 T1217S probably benign Het
Ipo7 A G 7: 110,047,065 D557G probably damaging Het
Irx3 T A 8: 91,799,835 T414S probably benign Het
Jakmip1 G A 5: 37,187,154 E1313K probably damaging Het
Kbtbd12 T C 6: 88,618,266 D194G probably damaging Het
Klk6 T C 7: 43,826,874 L46P probably damaging Het
Krt86 T C 15: 101,476,936 I329T probably benign Het
Mroh5 A G 15: 73,789,968 probably null Het
Mtrf1 T C 14: 79,413,081 V323A probably damaging Het
Oas3 A T 5: 120,758,874 I894N probably damaging Het
Oplah C T 15: 76,300,853 V887I possibly damaging Het
Pag1 T C 3: 9,699,788 T102A probably benign Het
Pcnx C T 12: 81,962,722 A1181V possibly damaging Het
Pkdrej G T 15: 85,817,309 Y1475* probably null Het
Pla2g5 A G 4: 138,800,653 S101P probably benign Het
Plekha4 C A 7: 45,534,817 A76E probably damaging Het
Plk2 T C 13: 110,399,791 I592T probably benign Het
Ppp2r3a A T 9: 101,212,862 H87Q probably benign Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Prrt4 G T 6: 29,176,552 T258K possibly damaging Het
Rhpn2 T A 7: 35,383,769 probably null Het
Slc11a1 T A 1: 74,384,085 I365N probably damaging Het
Slc7a7 C T 14: 54,374,651 G265D possibly damaging Het
Thsd7a T A 6: 12,555,637 T83S possibly damaging Het
Tln2 A G 9: 67,262,905 S1989P probably damaging Het
Tnfaip3 T G 10: 19,005,576 T321P probably benign Het
Tnrc6b C T 15: 80,924,119 P1623L possibly damaging Het
Trpa1 T C 1: 14,912,377 N85S probably benign Het
Trrap C T 5: 144,851,256 R3544* probably null Het
Ttf2 A T 3: 100,952,553 V695E probably benign Het
Ttll4 A G 1: 74,681,353 E509G probably damaging Het
Vdr T C 15: 97,869,828 I94V probably damaging Het
Wdfy3 G T 5: 101,884,045 Q2304K possibly damaging Het
Zfp663 T C 2: 165,359,015 Y33C probably damaging Het
Other mutations in Ppp2r3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Ppp2r3c APN 12 55292498 splice site probably null
IGL01122:Ppp2r3c APN 12 55297802 missense probably benign 0.20
IGL01954:Ppp2r3c APN 12 55292568 missense probably damaging 1.00
IGL02939:Ppp2r3c APN 12 55298407 unclassified probably benign
R0045:Ppp2r3c UTSW 12 55293821 missense probably damaging 0.99
R0129:Ppp2r3c UTSW 12 55298422 missense probably damaging 0.96
R2411:Ppp2r3c UTSW 12 55298484 missense probably benign 0.19
R4468:Ppp2r3c UTSW 12 55297883 nonsense probably null
R4746:Ppp2r3c UTSW 12 55302635 unclassified probably null
R5499:Ppp2r3c UTSW 12 55288626 missense probably benign 0.09
R5724:Ppp2r3c UTSW 12 55297832 missense probably benign 0.45
R6724:Ppp2r3c UTSW 12 55288496 missense probably benign 0.02
R7706:Ppp2r3c UTSW 12 55281705 missense probably benign 0.23
R7975:Ppp2r3c UTSW 12 55287993 nonsense probably null
R8111:Ppp2r3c UTSW 12 55297849 missense probably benign
RF006:Ppp2r3c UTSW 12 55293815 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- ATGCACACACTCTGCTTCAGAC -3'
(R):5'- CCCCTCTTTTGAGCTGGTGG -3'

Sequencing Primer
(F):5'- TGCTTCAGACACCTACGCAGTG -3'
(R):5'- GCTTCACCCAGACTGTTA -3'
Posted On2018-08-29