Mutagenetix > Incidental Mutation

Incidental Mutation 'R6776:Daam1'

531308

Institutional Source

Beutler Lab

Gene Symbol

Daam1

Ensembl Gene

ENSMUSG00000034574

Gene Name

dishevelled associated activator of morphogenesis 1

Synonyms

1700066F09Rik, 2310028E21Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6776 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

71831078-71992333 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 71989808 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 1052 (L1052F)

Ref Sequence

ENSEMBL: ENSMUSP00000152564 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085299] [ENSMUST00000221317] [ENSMUST00000223272]

AlphaFold

Q8BPM0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085299
AA Change: L1052F

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000082406
Gene: ENSMUSG00000034574
AA Change: L1052F

Domain	Start	End	E-Value	Type
Drf_GBD	45	232	4.99e-67	SMART
Drf_FH3	235	433	1.92e-77	SMART
SCOP:d1eq1a_	442	522	4e-3	SMART
Blast:Drf_FH3	459	519	1e-9	BLAST
SCOP:d1jvr__	532	565	5e-3	SMART
FH2	600	1060	9.99e-110	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000221317
AA Change: L1043F

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000223272
AA Change: L1052F

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell motility, adhesion, cytokinesis, and other functions of the cell cortex are mediated by reorganization of the actin cytoskeleton and several formin homology (FH) proteins have been associated with these processes. The protein encoded by this gene contains two FH domains and belongs to a novel FH protein subfamily implicated in cell polarity. A key regulator of cytoskeletal architecture, the small GTPase Rho, is activated during development by Wnt/Fz signaling to control cell polarity and movement. The protein encoded by this gene is thought to function as a scaffolding protein for the Wnt-induced assembly of a disheveled (Dvl)-Rho complex. This protein also promotes the nucleation and elongation of new actin filaments and regulates cell growth through the stabilization of microtubules. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a gene trap allele show reduced fetal size, partial embryonic and neonatal lethality, altered cytoskeletal structure, cardiac defects including ventricular noncompaction, double outlet right ventricles and ventricular septal defects, and impaired cell adhesion and wound healing. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1500015O10Rik	C	A	1: 43,742,391	N144K	probably damaging	Het
2900011O08Rik	T	A	16: 13,986,806	S6T	possibly damaging	Het
Abhd13	A	G	8: 9,988,075	H224R	probably benign	Het
Anapc10	T	C	8: 79,719,745	F68S	probably damaging	Het
Arid2	A	G	15: 96,370,949	N981S	probably benign	Het
BC055324	T	C	1: 163,976,749	I338M	probably damaging	Het
Cfap73	A	G	5: 120,634,211	F9L	probably damaging	Het
Chd3	A	C	11: 69,354,470	L1141V	probably damaging	Het
Dmxl1	C	T	18: 49,893,974	R2050C	probably damaging	Het
Dpp10	G	A	1: 123,367,656	Q552*	probably null	Het
Dysf	A	G	6: 84,064,894	D160G	possibly damaging	Het
Foxp1	TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG	TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG	6: 99,075,965		probably benign	Het
Ftcd	T	C	10: 76,589,239	I518T	probably benign	Het
Gapdh	A	G	6: 125,162,273	S248P	probably damaging	Het
Gm5592	C	G	7: 41,289,729	P812A	probably damaging	Het
Grik2	G	A	10: 49,355,989	L482F	probably damaging	Het
Gzmg	C	T	14: 56,156,831	G202D	probably damaging	Het
Hectd4	G	A	5: 121,353,511	A3671T	possibly damaging	Het
Hexa	G	T	9: 59,558,072	W203C	probably damaging	Het
Igdcc4	A	T	9: 65,135,418	T1217S	probably benign	Het
Ipo7	A	G	7: 110,047,065	D557G	probably damaging	Het
Irx3	T	A	8: 91,799,835	T414S	probably benign	Het
Jakmip1	G	A	5: 37,187,154	E1313K	probably damaging	Het
Kbtbd12	T	C	6: 88,618,266	D194G	probably damaging	Het
Klk6	T	C	7: 43,826,874	L46P	probably damaging	Het
Krt86	T	C	15: 101,476,936	I329T	probably benign	Het
Mroh5	A	G	15: 73,789,968		probably null	Het
Mtrf1	T	C	14: 79,413,081	V323A	probably damaging	Het
Oas3	A	T	5: 120,758,874	I894N	probably damaging	Het
Oplah	C	T	15: 76,300,853	V887I	possibly damaging	Het
Pag1	T	C	3: 9,699,788	T102A	probably benign	Het
Pcnx	C	T	12: 81,962,722	A1181V	possibly damaging	Het
Pkdrej	G	T	15: 85,817,309	Y1475*	probably null	Het
Pla2g5	A	G	4: 138,800,653	S101P	probably benign	Het
Plekha4	C	A	7: 45,534,817	A76E	probably damaging	Het
Plk2	T	C	13: 110,399,791	I592T	probably benign	Het
Ppp2r3a	A	T	9: 101,212,862	H87Q	probably benign	Het
Ppp2r3c	T	A	12: 55,298,467	R79*	probably null	Het
Prpf40b	C	T	15: 99,314,903	R627W	probably damaging	Het
Prrt4	G	T	6: 29,176,552	T258K	possibly damaging	Het
Rhpn2	T	A	7: 35,383,769		probably null	Het
Slc11a1	T	A	1: 74,384,085	I365N	probably damaging	Het
Slc7a7	C	T	14: 54,374,651	G265D	possibly damaging	Het
Thsd7a	T	A	6: 12,555,637	T83S	possibly damaging	Het
Tln2	A	G	9: 67,262,905	S1989P	probably damaging	Het
Tnfaip3	T	G	10: 19,005,576	T321P	probably benign	Het
Tnrc6b	C	T	15: 80,924,119	P1623L	possibly damaging	Het
Trpa1	T	C	1: 14,912,377	N85S	probably benign	Het
Trrap	C	T	5: 144,851,256	R3544*	probably null	Het
Ttf2	A	T	3: 100,952,553	V695E	probably benign	Het
Ttll4	A	G	1: 74,681,353	E509G	probably damaging	Het
Vdr	T	C	15: 97,869,828	I94V	probably damaging	Het
Wdfy3	G	T	5: 101,884,045	Q2304K	possibly damaging	Het
Zfp663	T	C	2: 165,359,015	Y33C	probably damaging	Het

Other mutations in Daam1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Daam1	APN	12	71942219	missense	unknown
IGL00323:Daam1	APN	12	71958743	splice site	probably benign
IGL00885:Daam1	APN	12	71944091	missense	unknown
IGL01768:Daam1	APN	12	71989885	missense	probably benign	0.39
IGL02189:Daam1	APN	12	71946285	missense	unknown
IGL02237:Daam1	APN	12	71982721	missense	probably benign	0.01
IGL02486:Daam1	APN	12	71947145	splice site	probably benign
IGL02561:Daam1	APN	12	71946516	missense	unknown
IGL02699:Daam1	APN	12	71988943	missense	probably damaging	1.00
IGL02977:Daam1	APN	12	71944172	missense	unknown
R0390:Daam1	UTSW	12	71975304	splice site	probably benign
R0492:Daam1	UTSW	12	71944380	missense	unknown
R0780:Daam1	UTSW	12	71947050	missense	unknown
R0973:Daam1	UTSW	12	71915784	missense	unknown
R0973:Daam1	UTSW	12	71915784	missense	unknown
R0974:Daam1	UTSW	12	71915784	missense	unknown
R1264:Daam1	UTSW	12	71975311	splice site	probably benign
R1462:Daam1	UTSW	12	71944142	missense	unknown
R1462:Daam1	UTSW	12	71944142	missense	unknown
R1510:Daam1	UTSW	12	71977726	missense	probably damaging	1.00
R1535:Daam1	UTSW	12	71951918	missense	unknown
R1688:Daam1	UTSW	12	71947046	missense	unknown
R1713:Daam1	UTSW	12	71895882	missense	unknown
R1957:Daam1	UTSW	12	71982755	critical splice donor site	probably null
R1974:Daam1	UTSW	12	71988929	missense	probably damaging	0.99
R2217:Daam1	UTSW	12	71989827	missense	probably damaging	1.00
R2507:Daam1	UTSW	12	71975223	missense	probably damaging	1.00
R2508:Daam1	UTSW	12	71975223	missense	probably damaging	1.00
R3161:Daam1	UTSW	12	71947098	missense	unknown
R3748:Daam1	UTSW	12	71971166	missense	probably damaging	1.00
R3749:Daam1	UTSW	12	71971166	missense	probably damaging	1.00
R4635:Daam1	UTSW	12	71958744	splice site	probably null
R4862:Daam1	UTSW	12	71942207	missense	unknown
R5033:Daam1	UTSW	12	71946520	missense	unknown
R5180:Daam1	UTSW	12	71947125	missense	unknown
R5202:Daam1	UTSW	12	71944274	missense	unknown
R5254:Daam1	UTSW	12	71946576	missense	unknown
R5358:Daam1	UTSW	12	71952459	nonsense	probably null
R5413:Daam1	UTSW	12	71946292	missense	unknown
R5733:Daam1	UTSW	12	71945498	missense	unknown
R5752:Daam1	UTSW	12	71946546	missense	unknown
R5891:Daam1	UTSW	12	71944149	missense	unknown
R6111:Daam1	UTSW	12	71942264	missense	unknown
R6182:Daam1	UTSW	12	71959887	nonsense	probably null
R6251:Daam1	UTSW	12	71988949	missense	probably damaging	1.00
R6252:Daam1	UTSW	12	71988949	missense	probably damaging	1.00
R6291:Daam1	UTSW	12	71946251	missense	unknown
R6379:Daam1	UTSW	12	71951938	missense	unknown
R7167:Daam1	UTSW	12	71988904	missense	probably damaging	0.99
R7223:Daam1	UTSW	12	71988943	missense	probably damaging	1.00
R7340:Daam1	UTSW	12	71988939	missense	probably benign	0.28
R7467:Daam1	UTSW	12	71985806	nonsense	probably null
R7709:Daam1	UTSW	12	71977649	missense	probably benign	0.10
R7715:Daam1	UTSW	12	71988901	missense	probably benign	0.15
R8157:Daam1	UTSW	12	71952489	missense	probably damaging	1.00
R8187:Daam1	UTSW	12	71895828	missense	unknown
R8297:Daam1	UTSW	12	71951915	missense	unknown
R8963:Daam1	UTSW	12	71945244	missense	unknown
R9283:Daam1	UTSW	12	71988922	missense	probably damaging	1.00
R9402:Daam1	UTSW	12	71959830	missense	probably benign	0.09
R9563:Daam1	UTSW	12	71945477	missense	unknown
R9696:Daam1	UTSW	12	71944373	missense	unknown
R9762:Daam1	UTSW	12	71944081	missense	unknown
R9803:Daam1	UTSW	12	71944148	missense	unknown
X0019:Daam1	UTSW	12	71985692	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGCTTCACATAGGAGATTCATTC -3'
(R):5'- TGTTTTGGATCGCAAGGCAG -3'

Sequencing Primer
(F):5'- ATAGGAGATTCATTCCCTGCCGTG -3'
(R):5'- CAGTGTAATGGAAAGTTCTGGTCACC -3'

Posted On

2018-08-29