Incidental Mutation 'R6776:Slc7a7'
List |< first << previous [record 44 of 55] next >> last >|
ID531311
Institutional Source Beutler Lab
Gene Symbol Slc7a7
Ensembl Gene ENSMUSG00000000958
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 7
Synonymsmy+lat1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6776 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location54369442-54417780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 54374651 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 265 (G265D)
Ref Sequence ENSEMBL: ENSMUSP00000143743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000984] [ENSMUST00000000985] [ENSMUST00000195970] [ENSMUST00000197440] [ENSMUST00000200545] [ENSMUST00000226753] [ENSMUST00000228488]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000984
AA Change: G265D

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000000984
Gene: ENSMUSG00000000958
AA Change: G265D

DomainStartEndE-ValueType
Pfam:AA_permease_2 38 463 2e-64 PFAM
Pfam:AA_permease 43 463 6.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000000985
SMART Domains Protein: ENSMUSP00000000985
Gene: ENSMUSG00000000959

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
low complexity region 29 41 N/A INTRINSIC
Pfam:60KD_IMP 135 330 4.1e-28 PFAM
low complexity region 406 427 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000195970
AA Change: G265D

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143091
Gene: ENSMUSG00000000958
AA Change: G265D

DomainStartEndE-ValueType
Pfam:AA_permease_2 38 462 6.4e-66 PFAM
Pfam:AA_permease 43 467 5.3e-31 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000197440
AA Change: G265D

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143743
Gene: ENSMUSG00000000958
AA Change: G265D

DomainStartEndE-ValueType
Pfam:AA_permease_2 38 463 2e-64 PFAM
Pfam:AA_permease 43 463 6.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200545
SMART Domains Protein: ENSMUSP00000142587
Gene: ENSMUSG00000000958

DomainStartEndE-ValueType
Pfam:Trp_Tyr_perm 36 183 7.5e-5 PFAM
Pfam:AA_permease_2 38 186 4.3e-19 PFAM
Pfam:AA_permease 43 185 2.4e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226753
AA Change: G265D
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228488
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the light subunit of a cationic amino acid transporter. This sodium-independent transporter is formed when the light subunit encoded by this gene dimerizes with the heavy subunit transporter protein SLC3A2. This transporter is found in epithelial cell membranes where it transfers cationic and large neutral amino acids from the cell to the extracellular space. Defects in this gene are a cause of lysinuric protein intolerance (LPI). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygous null mice exhibit fetal growth retardation and often die neonatally. After heavy protein ingestion, surviving adults show a metabolic derangement akin to lysinuric protein intolerance and including a lasting postnatal growth retardation, splenomegaly, hyperammonemia, and aminoaciduria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik C A 1: 43,742,391 N144K probably damaging Het
2900011O08Rik T A 16: 13,986,806 S6T possibly damaging Het
Abhd13 A G 8: 9,988,075 H224R probably benign Het
Anapc10 T C 8: 79,719,745 F68S probably damaging Het
Arid2 A G 15: 96,370,949 N981S probably benign Het
BC055324 T C 1: 163,976,749 I338M probably damaging Het
Cfap73 A G 5: 120,634,211 F9L probably damaging Het
Chd3 A C 11: 69,354,470 L1141V probably damaging Het
Daam1 C T 12: 71,989,808 L1052F possibly damaging Het
Dmxl1 C T 18: 49,893,974 R2050C probably damaging Het
Dpp10 G A 1: 123,367,656 Q552* probably null Het
Dysf A G 6: 84,064,894 D160G possibly damaging Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,965 probably benign Het
Ftcd T C 10: 76,589,239 I518T probably benign Het
Gapdh A G 6: 125,162,273 S248P probably damaging Het
Gm5592 C G 7: 41,289,729 P812A probably damaging Het
Grik2 G A 10: 49,355,989 L482F probably damaging Het
Gzmg C T 14: 56,156,831 G202D probably damaging Het
Hectd4 G A 5: 121,353,511 A3671T possibly damaging Het
Hexa G T 9: 59,558,072 W203C probably damaging Het
Igdcc4 A T 9: 65,135,418 T1217S probably benign Het
Ipo7 A G 7: 110,047,065 D557G probably damaging Het
Irx3 T A 8: 91,799,835 T414S probably benign Het
Jakmip1 G A 5: 37,187,154 E1313K probably damaging Het
Kbtbd12 T C 6: 88,618,266 D194G probably damaging Het
Klk6 T C 7: 43,826,874 L46P probably damaging Het
Krt86 T C 15: 101,476,936 I329T probably benign Het
Mroh5 A G 15: 73,789,968 probably null Het
Mtrf1 T C 14: 79,413,081 V323A probably damaging Het
Oas3 A T 5: 120,758,874 I894N probably damaging Het
Oplah C T 15: 76,300,853 V887I possibly damaging Het
Pag1 T C 3: 9,699,788 T102A probably benign Het
Pcnx C T 12: 81,962,722 A1181V possibly damaging Het
Pkdrej G T 15: 85,817,309 Y1475* probably null Het
Pla2g5 A G 4: 138,800,653 S101P probably benign Het
Plekha4 C A 7: 45,534,817 A76E probably damaging Het
Plk2 T C 13: 110,399,791 I592T probably benign Het
Ppp2r3a A T 9: 101,212,862 H87Q probably benign Het
Ppp2r3c T A 12: 55,298,467 R79* probably null Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Prrt4 G T 6: 29,176,552 T258K possibly damaging Het
Rhpn2 T A 7: 35,383,769 probably null Het
Slc11a1 T A 1: 74,384,085 I365N probably damaging Het
Thsd7a T A 6: 12,555,637 T83S possibly damaging Het
Tln2 A G 9: 67,262,905 S1989P probably damaging Het
Tnfaip3 T G 10: 19,005,576 T321P probably benign Het
Tnrc6b C T 15: 80,924,119 P1623L possibly damaging Het
Trpa1 T C 1: 14,912,377 N85S probably benign Het
Trrap C T 5: 144,851,256 R3544* probably null Het
Ttf2 A T 3: 100,952,553 V695E probably benign Het
Ttll4 A G 1: 74,681,353 E509G probably damaging Het
Vdr T C 15: 97,869,828 I94V probably damaging Het
Wdfy3 G T 5: 101,884,045 Q2304K possibly damaging Het
Zfp663 T C 2: 165,359,015 Y33C probably damaging Het
Other mutations in Slc7a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0200:Slc7a7 UTSW 14 54377802 missense probably damaging 1.00
R0331:Slc7a7 UTSW 14 54377924 unclassified probably benign
R0608:Slc7a7 UTSW 14 54377802 missense probably damaging 1.00
R1311:Slc7a7 UTSW 14 54373030 nonsense probably null
R1489:Slc7a7 UTSW 14 54408646 missense probably damaging 1.00
R1490:Slc7a7 UTSW 14 54408646 missense probably damaging 1.00
R4049:Slc7a7 UTSW 14 54373091 critical splice acceptor site probably null
R4731:Slc7a7 UTSW 14 54408733 missense probably damaging 1.00
R4732:Slc7a7 UTSW 14 54408733 missense probably damaging 1.00
R4733:Slc7a7 UTSW 14 54408733 missense probably damaging 1.00
R5562:Slc7a7 UTSW 14 54408812 missense probably benign
R5745:Slc7a7 UTSW 14 54377835 missense possibly damaging 0.46
R5907:Slc7a7 UTSW 14 54379103 missense probably damaging 1.00
R6140:Slc7a7 UTSW 14 54379058 missense probably damaging 1.00
R6366:Slc7a7 UTSW 14 54374600 missense probably damaging 1.00
R6696:Slc7a7 UTSW 14 54377761 splice site probably null
R7310:Slc7a7 UTSW 14 54379025 missense probably damaging 0.99
R7399:Slc7a7 UTSW 14 54374268 missense possibly damaging 0.87
R7903:Slc7a7 UTSW 14 54373909 missense probably damaging 1.00
R7986:Slc7a7 UTSW 14 54373909 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCCCAGTATCCTTGAGTTC -3'
(R):5'- GCTTACGCCAATACTTCAAGGC -3'

Sequencing Primer
(F):5'- AGTATCCTTGAGTTCTTATCAGGC -3'
(R):5'- GGCAACTTCAAAGGCAAAGGACC -3'
Posted On2018-08-29