Incidental Mutation 'R6776:Gzmg'
List |< first << previous [record 18 of 55] next >> last >|
ID531312
Institutional Source Beutler Lab
Gene Symbol Gzmg
Ensembl Gene ENSMUSG00000040284
Gene Namegranzyme G
SynonymsCtla-7, Ctla7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6776 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location56156582-56159579 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 56156831 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 202 (G202D)
Ref Sequence ENSEMBL: ENSMUSP00000015578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015578]
Predicted Effect probably damaging
Transcript: ENSMUST00000015578
AA Change: G202D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015578
Gene: ENSMUSG00000040284
AA Change: G202D

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Tryp_SPc 20 241 6.39e-82 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik C A 1: 43,742,391 N144K probably damaging Het
2900011O08Rik T A 16: 13,986,806 S6T possibly damaging Het
Abhd13 A G 8: 9,988,075 H224R probably benign Het
Anapc10 T C 8: 79,719,745 F68S probably damaging Het
Arid2 A G 15: 96,370,949 N981S probably benign Het
BC055324 T C 1: 163,976,749 I338M probably damaging Het
Cfap73 A G 5: 120,634,211 F9L probably damaging Het
Chd3 A C 11: 69,354,470 L1141V probably damaging Het
Daam1 C T 12: 71,989,808 L1052F possibly damaging Het
Dmxl1 C T 18: 49,893,974 R2050C probably damaging Het
Dpp10 G A 1: 123,367,656 Q552* probably null Het
Dysf A G 6: 84,064,894 D160G possibly damaging Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,965 probably benign Het
Ftcd T C 10: 76,589,239 I518T probably benign Het
Gapdh A G 6: 125,162,273 S248P probably damaging Het
Gm5592 C G 7: 41,289,729 P812A probably damaging Het
Grik2 G A 10: 49,355,989 L482F probably damaging Het
Hectd4 G A 5: 121,353,511 A3671T possibly damaging Het
Hexa G T 9: 59,558,072 W203C probably damaging Het
Igdcc4 A T 9: 65,135,418 T1217S probably benign Het
Ipo7 A G 7: 110,047,065 D557G probably damaging Het
Irx3 T A 8: 91,799,835 T414S probably benign Het
Jakmip1 G A 5: 37,187,154 E1313K probably damaging Het
Kbtbd12 T C 6: 88,618,266 D194G probably damaging Het
Klk6 T C 7: 43,826,874 L46P probably damaging Het
Krt86 T C 15: 101,476,936 I329T probably benign Het
Mroh5 A G 15: 73,789,968 probably null Het
Mtrf1 T C 14: 79,413,081 V323A probably damaging Het
Oas3 A T 5: 120,758,874 I894N probably damaging Het
Oplah C T 15: 76,300,853 V887I possibly damaging Het
Pag1 T C 3: 9,699,788 T102A probably benign Het
Pcnx C T 12: 81,962,722 A1181V possibly damaging Het
Pkdrej G T 15: 85,817,309 Y1475* probably null Het
Pla2g5 A G 4: 138,800,653 S101P probably benign Het
Plekha4 C A 7: 45,534,817 A76E probably damaging Het
Plk2 T C 13: 110,399,791 I592T probably benign Het
Ppp2r3a A T 9: 101,212,862 H87Q probably benign Het
Ppp2r3c T A 12: 55,298,467 R79* probably null Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Prrt4 G T 6: 29,176,552 T258K possibly damaging Het
Rhpn2 T A 7: 35,383,769 probably null Het
Slc11a1 T A 1: 74,384,085 I365N probably damaging Het
Slc7a7 C T 14: 54,374,651 G265D possibly damaging Het
Thsd7a T A 6: 12,555,637 T83S possibly damaging Het
Tln2 A G 9: 67,262,905 S1989P probably damaging Het
Tnfaip3 T G 10: 19,005,576 T321P probably benign Het
Tnrc6b C T 15: 80,924,119 P1623L possibly damaging Het
Trpa1 T C 1: 14,912,377 N85S probably benign Het
Trrap C T 5: 144,851,256 R3544* probably null Het
Ttf2 A T 3: 100,952,553 V695E probably benign Het
Ttll4 A G 1: 74,681,353 E509G probably damaging Het
Vdr T C 15: 97,869,828 I94V probably damaging Het
Wdfy3 G T 5: 101,884,045 Q2304K possibly damaging Het
Zfp663 T C 2: 165,359,015 Y33C probably damaging Het
Other mutations in Gzmg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02064:Gzmg APN 14 56157341 missense probably benign 0.00
IGL02323:Gzmg APN 14 56157272 missense probably benign 0.01
IGL02633:Gzmg APN 14 56156703 missense probably damaging 0.99
R0456:Gzmg UTSW 14 56158322 missense probably damaging 1.00
R1368:Gzmg UTSW 14 56157806 missense probably benign 0.41
R1663:Gzmg UTSW 14 56156808 missense probably damaging 1.00
R2511:Gzmg UTSW 14 56158375 missense probably benign 0.00
R3691:Gzmg UTSW 14 56157677 splice site probably benign
R4509:Gzmg UTSW 14 56156753 missense probably damaging 1.00
R7175:Gzmg UTSW 14 56159522 start codon destroyed probably null
R7502:Gzmg UTSW 14 56156827 missense not run
R8022:Gzmg UTSW 14 56157446 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- CCATGTGGTTCTTGCCTGAG -3'
(R):5'- AGTGGGAAAACCTCTGTCATC -3'

Sequencing Primer
(F):5'- TCTTGCCTGAGGTCGGACAG -3'
(R):5'- CCTCTGTCATCCCAAACAGG -3'
Posted On2018-08-29