Incidental Mutation 'R6776:Oplah'
ID531315
Institutional Source Beutler Lab
Gene Symbol Oplah
Ensembl Gene ENSMUSG00000022562
Gene Name5-oxoprolinase (ATP-hydrolysing)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R6776 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location76296601-76328015 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 76300853 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 887 (V887I)
Ref Sequence ENSEMBL: ENSMUSP00000129100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023222] [ENSMUST00000163991] [ENSMUST00000164189] [ENSMUST00000171192] [ENSMUST00000171340] [ENSMUST00000210024]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023222
AA Change: V887I

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000023222
Gene: ENSMUSG00000022562
AA Change: V887I

DomainStartEndE-ValueType
Pfam:Hydant_A_N 9 212 1.5e-63 PFAM
Pfam:Hydantoinase_A 231 531 6.4e-109 PFAM
low complexity region 629 637 N/A INTRINSIC
Pfam:Hydantoinase_B 734 1256 5.2e-225 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163991
SMART Domains Protein: ENSMUSP00000134687
Gene: ENSMUSG00000071724

DomainStartEndE-ValueType
transmembrane domain 77 99 N/A INTRINSIC
Pfam:Exo_endo_phos 176 471 4.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164189
SMART Domains Protein: ENSMUSP00000131967
Gene: ENSMUSG00000022562

DomainStartEndE-ValueType
Pfam:Hydant_A_N 9 212 9.8e-61 PFAM
Pfam:Hydantoinase_A 231 531 6.9e-103 PFAM
low complexity region 629 637 N/A INTRINSIC
Pfam:Hydantoinase_B 733 853 2.3e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171192
SMART Domains Protein: ENSMUSP00000133693
Gene: ENSMUSG00000071724

DomainStartEndE-ValueType
low complexity region 35 46 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000171340
AA Change: V887I

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129100
Gene: ENSMUSG00000022562
AA Change: V887I

DomainStartEndE-ValueType
Pfam:Hydant_A_N 9 212 2.8e-60 PFAM
Pfam:Hydantoinase_A 231 531 6.6e-102 PFAM
low complexity region 629 637 N/A INTRINSIC
Pfam:Hydantoinase_B 733 1260 8.2e-190 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210024
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a homodimer, using ATP hydrolysis to catalyze the conversion of 5-oxo-L-proline to L-glutamate. Defects in this gene are a cause of 5-oxoprolinase deficiency (OPLAHD). [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik C A 1: 43,742,391 N144K probably damaging Het
2900011O08Rik T A 16: 13,986,806 S6T possibly damaging Het
Abhd13 A G 8: 9,988,075 H224R probably benign Het
Anapc10 T C 8: 79,719,745 F68S probably damaging Het
Arid2 A G 15: 96,370,949 N981S probably benign Het
BC055324 T C 1: 163,976,749 I338M probably damaging Het
Cfap73 A G 5: 120,634,211 F9L probably damaging Het
Chd3 A C 11: 69,354,470 L1141V probably damaging Het
Daam1 C T 12: 71,989,808 L1052F possibly damaging Het
Dmxl1 C T 18: 49,893,974 R2050C probably damaging Het
Dpp10 G A 1: 123,367,656 Q552* probably null Het
Dysf A G 6: 84,064,894 D160G possibly damaging Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,965 probably benign Het
Ftcd T C 10: 76,589,239 I518T probably benign Het
Gapdh A G 6: 125,162,273 S248P probably damaging Het
Gm5592 C G 7: 41,289,729 P812A probably damaging Het
Grik2 G A 10: 49,355,989 L482F probably damaging Het
Gzmg C T 14: 56,156,831 G202D probably damaging Het
Hectd4 G A 5: 121,353,511 A3671T possibly damaging Het
Hexa G T 9: 59,558,072 W203C probably damaging Het
Igdcc4 A T 9: 65,135,418 T1217S probably benign Het
Ipo7 A G 7: 110,047,065 D557G probably damaging Het
Irx3 T A 8: 91,799,835 T414S probably benign Het
Jakmip1 G A 5: 37,187,154 E1313K probably damaging Het
Kbtbd12 T C 6: 88,618,266 D194G probably damaging Het
Klk6 T C 7: 43,826,874 L46P probably damaging Het
Krt86 T C 15: 101,476,936 I329T probably benign Het
Mroh5 A G 15: 73,789,968 probably null Het
Mtrf1 T C 14: 79,413,081 V323A probably damaging Het
Oas3 A T 5: 120,758,874 I894N probably damaging Het
Pag1 T C 3: 9,699,788 T102A probably benign Het
Pcnx C T 12: 81,962,722 A1181V possibly damaging Het
Pkdrej G T 15: 85,817,309 Y1475* probably null Het
Pla2g5 A G 4: 138,800,653 S101P probably benign Het
Plekha4 C A 7: 45,534,817 A76E probably damaging Het
Plk2 T C 13: 110,399,791 I592T probably benign Het
Ppp2r3a A T 9: 101,212,862 H87Q probably benign Het
Ppp2r3c T A 12: 55,298,467 R79* probably null Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Prrt4 G T 6: 29,176,552 T258K possibly damaging Het
Rhpn2 T A 7: 35,383,769 probably null Het
Slc11a1 T A 1: 74,384,085 I365N probably damaging Het
Slc7a7 C T 14: 54,374,651 G265D possibly damaging Het
Thsd7a T A 6: 12,555,637 T83S possibly damaging Het
Tln2 A G 9: 67,262,905 S1989P probably damaging Het
Tnfaip3 T G 10: 19,005,576 T321P probably benign Het
Tnrc6b C T 15: 80,924,119 P1623L possibly damaging Het
Trpa1 T C 1: 14,912,377 N85S probably benign Het
Trrap C T 5: 144,851,256 R3544* probably null Het
Ttf2 A T 3: 100,952,553 V695E probably benign Het
Ttll4 A G 1: 74,681,353 E509G probably damaging Het
Vdr T C 15: 97,869,828 I94V probably damaging Het
Wdfy3 G T 5: 101,884,045 Q2304K possibly damaging Het
Zfp663 T C 2: 165,359,015 Y33C probably damaging Het
Other mutations in Oplah
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Oplah APN 15 76305748 missense probably damaging 1.00
IGL01132:Oplah APN 15 76300957 missense probably benign 0.28
IGL02252:Oplah APN 15 76304764 missense probably damaging 1.00
IGL02493:Oplah APN 15 76300955 nonsense probably null
R0033:Oplah UTSW 15 76297134 missense probably benign 0.03
R0418:Oplah UTSW 15 76298487 missense probably benign 0.06
R0609:Oplah UTSW 15 76302992 missense probably benign 0.00
R1374:Oplah UTSW 15 76306555 missense probably damaging 0.99
R1419:Oplah UTSW 15 76297920 missense probably benign 0.41
R1703:Oplah UTSW 15 76296667 missense probably benign 0.02
R1733:Oplah UTSW 15 76302483 nonsense probably null
R1959:Oplah UTSW 15 76297464 missense probably damaging 1.00
R1960:Oplah UTSW 15 76297464 missense probably damaging 1.00
R1961:Oplah UTSW 15 76297464 missense probably damaging 1.00
R2290:Oplah UTSW 15 76302725 missense probably benign 0.00
R3552:Oplah UTSW 15 76302094 missense possibly damaging 0.78
R4019:Oplah UTSW 15 76297276 missense probably damaging 1.00
R4020:Oplah UTSW 15 76297276 missense probably damaging 1.00
R4207:Oplah UTSW 15 76302710 missense probably damaging 1.00
R4512:Oplah UTSW 15 76297955 missense probably damaging 1.00
R4514:Oplah UTSW 15 76297955 missense probably damaging 1.00
R4525:Oplah UTSW 15 76305509 missense probably damaging 1.00
R4803:Oplah UTSW 15 76302768 missense probably damaging 1.00
R5042:Oplah UTSW 15 76305709 nonsense probably null
R5259:Oplah UTSW 15 76301210 intron probably null
R5284:Oplah UTSW 15 76306559 missense probably benign 0.00
R5503:Oplah UTSW 15 76305446 critical splice donor site probably null
R5511:Oplah UTSW 15 76305744 missense possibly damaging 0.74
R5549:Oplah UTSW 15 76298266 missense probably damaging 0.98
R5594:Oplah UTSW 15 76296637 makesense probably null
R5631:Oplah UTSW 15 76305241 missense probably benign 0.01
R5849:Oplah UTSW 15 76297347 unclassified probably benign
R7105:Oplah UTSW 15 76297687 missense probably damaging 1.00
R7146:Oplah UTSW 15 76302660 missense probably benign
R7267:Oplah UTSW 15 76305009 missense probably benign 0.00
R7403:Oplah UTSW 15 76305009 missense probably benign 0.00
R7786:Oplah UTSW 15 76309716 missense possibly damaging 0.93
R8029:Oplah UTSW 15 76305696 missense probably benign
R8054:Oplah UTSW 15 76306257 missense probably benign 0.00
X0065:Oplah UTSW 15 76305163 nonsense probably null
Z1177:Oplah UTSW 15 76298487 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TCTGAGATGGCTTACGACTGC -3'
(R):5'- AGATTTCTGGCACTGCTGAC -3'

Sequencing Primer
(F):5'- GAGAGGTCACCACTGTCTCTATCAAG -3'
(R):5'- TGACAGCTGCTGTTCGC -3'
Posted On2018-08-29