Incidental Mutation 'R6776:Tnrc6b'
List |< first << previous [record 48 of 55] next >> last >|
ID531316
Institutional Source Beutler Lab
Gene Symbol Tnrc6b
Ensembl Gene ENSMUSG00000047888
Gene Nametrinucleotide repeat containing 6b
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R6776 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location80711313-80941085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 80924119 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 1623 (P1623L)
Ref Sequence ENSEMBL: ENSMUSP00000064336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067689]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067689
AA Change: P1623L

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000064336
Gene: ENSMUSG00000047888
AA Change: P1623L

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
coiled coil region 33 72 N/A INTRINSIC
low complexity region 88 106 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 207 220 N/A INTRINSIC
low complexity region 242 260 N/A INTRINSIC
low complexity region 331 346 N/A INTRINSIC
low complexity region 363 380 N/A INTRINSIC
low complexity region 416 425 N/A INTRINSIC
low complexity region 475 487 N/A INTRINSIC
internal_repeat_1 488 667 6.43e-5 PROSPERO
low complexity region 858 888 N/A INTRINSIC
Pfam:Ago_hook 955 1095 1.2e-28 PFAM
coiled coil region 1258 1307 N/A INTRINSIC
Pfam:TNRC6-PABC_bdg 1339 1623 2.8e-112 PFAM
Pfam:RRM_5 1641 1695 2e-7 PFAM
low complexity region 1705 1721 N/A INTRINSIC
low complexity region 1748 1769 N/A INTRINSIC
low complexity region 1792 1809 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228124
AA Change: P770L
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal and postnatal lethality with decreased body weight and infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik C A 1: 43,742,391 N144K probably damaging Het
2900011O08Rik T A 16: 13,986,806 S6T possibly damaging Het
Abhd13 A G 8: 9,988,075 H224R probably benign Het
Anapc10 T C 8: 79,719,745 F68S probably damaging Het
Arid2 A G 15: 96,370,949 N981S probably benign Het
BC055324 T C 1: 163,976,749 I338M probably damaging Het
Cfap73 A G 5: 120,634,211 F9L probably damaging Het
Chd3 A C 11: 69,354,470 L1141V probably damaging Het
Daam1 C T 12: 71,989,808 L1052F possibly damaging Het
Dmxl1 C T 18: 49,893,974 R2050C probably damaging Het
Dpp10 G A 1: 123,367,656 Q552* probably null Het
Dysf A G 6: 84,064,894 D160G possibly damaging Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,965 probably benign Het
Ftcd T C 10: 76,589,239 I518T probably benign Het
Gapdh A G 6: 125,162,273 S248P probably damaging Het
Gm5592 C G 7: 41,289,729 P812A probably damaging Het
Grik2 G A 10: 49,355,989 L482F probably damaging Het
Gzmg C T 14: 56,156,831 G202D probably damaging Het
Hectd4 G A 5: 121,353,511 A3671T possibly damaging Het
Hexa G T 9: 59,558,072 W203C probably damaging Het
Igdcc4 A T 9: 65,135,418 T1217S probably benign Het
Ipo7 A G 7: 110,047,065 D557G probably damaging Het
Irx3 T A 8: 91,799,835 T414S probably benign Het
Jakmip1 G A 5: 37,187,154 E1313K probably damaging Het
Kbtbd12 T C 6: 88,618,266 D194G probably damaging Het
Klk6 T C 7: 43,826,874 L46P probably damaging Het
Krt86 T C 15: 101,476,936 I329T probably benign Het
Mroh5 A G 15: 73,789,968 probably null Het
Mtrf1 T C 14: 79,413,081 V323A probably damaging Het
Oas3 A T 5: 120,758,874 I894N probably damaging Het
Oplah C T 15: 76,300,853 V887I possibly damaging Het
Pag1 T C 3: 9,699,788 T102A probably benign Het
Pcnx C T 12: 81,962,722 A1181V possibly damaging Het
Pkdrej G T 15: 85,817,309 Y1475* probably null Het
Pla2g5 A G 4: 138,800,653 S101P probably benign Het
Plekha4 C A 7: 45,534,817 A76E probably damaging Het
Plk2 T C 13: 110,399,791 I592T probably benign Het
Ppp2r3a A T 9: 101,212,862 H87Q probably benign Het
Ppp2r3c T A 12: 55,298,467 R79* probably null Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Prrt4 G T 6: 29,176,552 T258K possibly damaging Het
Rhpn2 T A 7: 35,383,769 probably null Het
Slc11a1 T A 1: 74,384,085 I365N probably damaging Het
Slc7a7 C T 14: 54,374,651 G265D possibly damaging Het
Thsd7a T A 6: 12,555,637 T83S possibly damaging Het
Tln2 A G 9: 67,262,905 S1989P probably damaging Het
Tnfaip3 T G 10: 19,005,576 T321P probably benign Het
Trpa1 T C 1: 14,912,377 N85S probably benign Het
Trrap C T 5: 144,851,256 R3544* probably null Het
Ttf2 A T 3: 100,952,553 V695E probably benign Het
Ttll4 A G 1: 74,681,353 E509G probably damaging Het
Vdr T C 15: 97,869,828 I94V probably damaging Het
Wdfy3 G T 5: 101,884,045 Q2304K possibly damaging Het
Zfp663 T C 2: 165,359,015 Y33C probably damaging Het
Other mutations in Tnrc6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Tnrc6b APN 15 80923578 missense probably damaging 1.00
IGL01402:Tnrc6b APN 15 80880544 missense possibly damaging 0.71
IGL01505:Tnrc6b APN 15 80879963 missense probably benign 0.00
IGL01516:Tnrc6b APN 15 80902622 missense possibly damaging 0.93
IGL01584:Tnrc6b APN 15 80879682 missense probably benign 0.01
IGL01681:Tnrc6b APN 15 80879311 unclassified probably null
IGL01909:Tnrc6b APN 15 80901983 missense possibly damaging 0.88
IGL01943:Tnrc6b APN 15 80927695 nonsense probably null
IGL02253:Tnrc6b APN 15 80876541 missense probably damaging 0.99
IGL02260:Tnrc6b APN 15 80880171 missense probably damaging 0.99
IGL02437:Tnrc6b APN 15 80880457 missense probably damaging 1.00
IGL02541:Tnrc6b APN 15 80879831 missense probably benign 0.00
IGL02542:Tnrc6b APN 15 80902352 missense possibly damaging 0.83
grosser UTSW 15 80929285 missense probably damaging 1.00
heiliger UTSW 15 80927741 critical splice donor site probably null
PIT1430001:Tnrc6b UTSW 15 80929186 missense probably damaging 0.99
R0092:Tnrc6b UTSW 15 80918528 missense probably damaging 1.00
R0165:Tnrc6b UTSW 15 80858670 splice site probably null
R0238:Tnrc6b UTSW 15 80887864 missense probably damaging 1.00
R0238:Tnrc6b UTSW 15 80887864 missense probably damaging 1.00
R0257:Tnrc6b UTSW 15 80894355 missense possibly damaging 0.80
R0418:Tnrc6b UTSW 15 80913323 missense probably benign 0.27
R0432:Tnrc6b UTSW 15 80923446 splice site probably benign
R0487:Tnrc6b UTSW 15 80880675 missense probably benign 0.01
R0498:Tnrc6b UTSW 15 80858719 missense probably damaging 0.98
R0528:Tnrc6b UTSW 15 80879403 missense probably benign 0.00
R0533:Tnrc6b UTSW 15 80876653 missense probably benign 0.00
R0571:Tnrc6b UTSW 15 80913338 missense probably damaging 1.00
R0650:Tnrc6b UTSW 15 80784758 missense probably benign 0.33
R0659:Tnrc6b UTSW 15 80923446 splice site probably benign
R0884:Tnrc6b UTSW 15 80902555 small deletion probably benign
R1131:Tnrc6b UTSW 15 80894453 missense possibly damaging 0.45
R1188:Tnrc6b UTSW 15 80879229 missense probably benign
R1479:Tnrc6b UTSW 15 80887032 unclassified probably null
R1564:Tnrc6b UTSW 15 80880168 missense possibly damaging 0.95
R1645:Tnrc6b UTSW 15 80882958 missense probably damaging 0.99
R1924:Tnrc6b UTSW 15 80884206 critical splice acceptor site probably null
R1926:Tnrc6b UTSW 15 80881162 missense probably damaging 1.00
R1928:Tnrc6b UTSW 15 80880723 missense probably damaging 1.00
R1965:Tnrc6b UTSW 15 80880439 missense probably damaging 1.00
R1966:Tnrc6b UTSW 15 80880439 missense probably damaging 1.00
R2072:Tnrc6b UTSW 15 80882965 missense possibly damaging 0.89
R3084:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R3552:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R3736:Tnrc6b UTSW 15 80889163 splice site probably benign
R3791:Tnrc6b UTSW 15 80923640 missense probably damaging 1.00
R4170:Tnrc6b UTSW 15 80916787 missense probably benign 0.24
R4276:Tnrc6b UTSW 15 80901971 missense probably benign 0.42
R4519:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R5380:Tnrc6b UTSW 15 80879565 missense possibly damaging 0.56
R5470:Tnrc6b UTSW 15 80916711 missense possibly damaging 0.89
R5590:Tnrc6b UTSW 15 80876502 missense probably damaging 0.98
R5982:Tnrc6b UTSW 15 80880816 missense probably benign
R6269:Tnrc6b UTSW 15 80880743 missense probably benign 0.42
R6331:Tnrc6b UTSW 15 80879614 missense probably benign 0.00
R6484:Tnrc6b UTSW 15 80879324 missense possibly damaging 0.92
R6622:Tnrc6b UTSW 15 80879184 missense probably damaging 0.99
R6695:Tnrc6b UTSW 15 80879773 missense probably damaging 1.00
R6728:Tnrc6b UTSW 15 80918526 missense probably damaging 1.00
R7159:Tnrc6b UTSW 15 80887022 missense possibly damaging 0.92
R7210:Tnrc6b UTSW 15 80929285 missense probably damaging 1.00
R7287:Tnrc6b UTSW 15 80879541 missense possibly damaging 0.83
R7402:Tnrc6b UTSW 15 80884300 missense probably damaging 1.00
R7479:Tnrc6b UTSW 15 80889126 missense probably benign 0.13
R7533:Tnrc6b UTSW 15 80927741 critical splice donor site probably null
R7571:Tnrc6b UTSW 15 80929393 missense probably benign
R7594:Tnrc6b UTSW 15 80880307 missense possibly damaging 0.66
R7831:Tnrc6b UTSW 15 80880379 missense possibly damaging 0.49
R7914:Tnrc6b UTSW 15 80880379 missense possibly damaging 0.49
X0020:Tnrc6b UTSW 15 80882997 missense probably benign 0.16
X0025:Tnrc6b UTSW 15 80881167 missense probably benign 0.03
Z1088:Tnrc6b UTSW 15 80927690 nonsense probably null
Z1177:Tnrc6b UTSW 15 80858699 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- CCGTGAAGGTCAGGATTAGG -3'
(R):5'- AGAGCTTTCATGTCTGCCAAC -3'

Sequencing Primer
(F):5'- CCCTGAGAGTCTTGGTTT -3'
(R):5'- AACTTGCTAACAGGCTGGC -3'
Posted On2018-08-29