Incidental Mutation 'R6776:Arid2'
ID531318
Institutional Source Beutler Lab
Gene Symbol Arid2
Ensembl Gene ENSMUSG00000033237
Gene NameAT rich interactive domain 2 (ARID, RFX-like)
Synonyms4432409D24Rik, 1700124K17Rik, zipzap/p200
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6776 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location96287518-96404992 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96370949 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 981 (N981S)
Ref Sequence ENSEMBL: ENSMUSP00000093969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096250]
Predicted Effect probably benign
Transcript: ENSMUST00000096250
AA Change: N981S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000093969
Gene: ENSMUSG00000033237
AA Change: N981S

DomainStartEndE-ValueType
ARID 10 101 9.67e-36 SMART
BRIGHT 14 106 3.67e-34 SMART
Pfam:RFX_DNA_binding 521 603 1.7e-26 PFAM
internal_repeat_1 767 843 3.29e-6 PROSPERO
low complexity region 902 942 N/A INTRINSIC
low complexity region 965 986 N/A INTRINSIC
low complexity region 1012 1054 N/A INTRINSIC
low complexity region 1118 1131 N/A INTRINSIC
internal_repeat_1 1132 1215 3.29e-6 PROSPERO
low complexity region 1453 1468 N/A INTRINSIC
low complexity region 1590 1614 N/A INTRINSIC
ZnF_C2H2 1626 1651 4.34e0 SMART
ZnF_C2H2 1659 1684 4.74e1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AT-rich interactive domain (ARID)-containing family of DNA-binding proteins. Members of the ARID family have roles in embryonic patterning, cell lineage gene regulation, cell cycle control, transcriptional regulation and chromatin structure modification. This protein functions as a subunit of the polybromo- and BRG1-associated factor or PBAF (SWI/SNF-B) chromatin remodeling complex which facilitates ligand-dependent transcriptional activation by nuclear receptors. Mutations in this gene are associated with hepatocellular carcinomas. A pseudogene of this gene is found on chromosome1. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E12.5 and E14.5, congenital heart defects, impaired coronary artery development, subcutaneous edema and hemorrhage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik C A 1: 43,742,391 N144K probably damaging Het
2900011O08Rik T A 16: 13,986,806 S6T possibly damaging Het
Abhd13 A G 8: 9,988,075 H224R probably benign Het
Anapc10 T C 8: 79,719,745 F68S probably damaging Het
BC055324 T C 1: 163,976,749 I338M probably damaging Het
Cfap73 A G 5: 120,634,211 F9L probably damaging Het
Chd3 A C 11: 69,354,470 L1141V probably damaging Het
Daam1 C T 12: 71,989,808 L1052F possibly damaging Het
Dmxl1 C T 18: 49,893,974 R2050C probably damaging Het
Dpp10 G A 1: 123,367,656 Q552* probably null Het
Dysf A G 6: 84,064,894 D160G possibly damaging Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,965 probably benign Het
Ftcd T C 10: 76,589,239 I518T probably benign Het
Gapdh A G 6: 125,162,273 S248P probably damaging Het
Gm5592 C G 7: 41,289,729 P812A probably damaging Het
Grik2 G A 10: 49,355,989 L482F probably damaging Het
Gzmg C T 14: 56,156,831 G202D probably damaging Het
Hectd4 G A 5: 121,353,511 A3671T possibly damaging Het
Hexa G T 9: 59,558,072 W203C probably damaging Het
Igdcc4 A T 9: 65,135,418 T1217S probably benign Het
Ipo7 A G 7: 110,047,065 D557G probably damaging Het
Irx3 T A 8: 91,799,835 T414S probably benign Het
Jakmip1 G A 5: 37,187,154 E1313K probably damaging Het
Kbtbd12 T C 6: 88,618,266 D194G probably damaging Het
Klk6 T C 7: 43,826,874 L46P probably damaging Het
Krt86 T C 15: 101,476,936 I329T probably benign Het
Mroh5 A G 15: 73,789,968 probably null Het
Mtrf1 T C 14: 79,413,081 V323A probably damaging Het
Oas3 A T 5: 120,758,874 I894N probably damaging Het
Oplah C T 15: 76,300,853 V887I possibly damaging Het
Pag1 T C 3: 9,699,788 T102A probably benign Het
Pcnx C T 12: 81,962,722 A1181V possibly damaging Het
Pkdrej G T 15: 85,817,309 Y1475* probably null Het
Pla2g5 A G 4: 138,800,653 S101P probably benign Het
Plekha4 C A 7: 45,534,817 A76E probably damaging Het
Plk2 T C 13: 110,399,791 I592T probably benign Het
Ppp2r3a A T 9: 101,212,862 H87Q probably benign Het
Ppp2r3c T A 12: 55,298,467 R79* probably null Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Prrt4 G T 6: 29,176,552 T258K possibly damaging Het
Rhpn2 T A 7: 35,383,769 probably null Het
Slc11a1 T A 1: 74,384,085 I365N probably damaging Het
Slc7a7 C T 14: 54,374,651 G265D possibly damaging Het
Thsd7a T A 6: 12,555,637 T83S possibly damaging Het
Tln2 A G 9: 67,262,905 S1989P probably damaging Het
Tnfaip3 T G 10: 19,005,576 T321P probably benign Het
Tnrc6b C T 15: 80,924,119 P1623L possibly damaging Het
Trpa1 T C 1: 14,912,377 N85S probably benign Het
Trrap C T 5: 144,851,256 R3544* probably null Het
Ttf2 A T 3: 100,952,553 V695E probably benign Het
Ttll4 A G 1: 74,681,353 E509G probably damaging Het
Vdr T C 15: 97,869,828 I94V probably damaging Het
Wdfy3 G T 5: 101,884,045 Q2304K possibly damaging Het
Zfp663 T C 2: 165,359,015 Y33C probably damaging Het
Other mutations in Arid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Arid2 APN 15 96372302 missense probably benign
IGL00321:Arid2 APN 15 96289089 missense probably damaging 0.97
IGL00434:Arid2 APN 15 96371300 missense probably damaging 0.99
IGL00576:Arid2 APN 15 96356758 missense probably damaging 0.99
IGL00766:Arid2 APN 15 96370405 missense probably benign 0.09
IGL01563:Arid2 APN 15 96372397 missense probably damaging 0.99
IGL01697:Arid2 APN 15 96361572 critical splice acceptor site probably null
IGL01845:Arid2 APN 15 96356797 missense probably damaging 1.00
IGL02159:Arid2 APN 15 96358912 splice site probably benign
IGL02341:Arid2 APN 15 96372185 missense probably benign
IGL02416:Arid2 APN 15 96350055 missense possibly damaging 0.63
IGL02578:Arid2 APN 15 96372235 missense probably benign 0.00
IGL02598:Arid2 APN 15 96371536 missense probably damaging 1.00
IGL02644:Arid2 APN 15 96368708 missense probably damaging 1.00
IGL02653:Arid2 APN 15 96287702 missense probably damaging 0.99
IGL03115:Arid2 APN 15 96370273 missense probably damaging 1.00
IGL03137:Arid2 APN 15 96371318 missense probably benign 0.44
IGL03220:Arid2 APN 15 96361772 missense probably damaging 0.99
IGL03249:Arid2 APN 15 96401965 missense probably damaging 1.00
IGL03256:Arid2 APN 15 96370762 missense probably benign 0.18
IGL03386:Arid2 APN 15 96361574 missense probably damaging 1.00
H8562:Arid2 UTSW 15 96369546 missense possibly damaging 0.77
I2288:Arid2 UTSW 15 96369511 missense possibly damaging 0.95
R0254:Arid2 UTSW 15 96370571 missense probably damaging 0.97
R0284:Arid2 UTSW 15 96378967 splice site probably benign
R0347:Arid2 UTSW 15 96370952 missense probably benign 0.01
R0366:Arid2 UTSW 15 96361720 splice site probably benign
R0400:Arid2 UTSW 15 96356925 unclassified probably benign
R0650:Arid2 UTSW 15 96402049 missense possibly damaging 0.47
R0651:Arid2 UTSW 15 96402049 missense possibly damaging 0.47
R1034:Arid2 UTSW 15 96369505 missense probably benign 0.01
R1615:Arid2 UTSW 15 96371654 missense possibly damaging 0.59
R1696:Arid2 UTSW 15 96370183 missense probably benign 0.01
R2024:Arid2 UTSW 15 96361799 missense probably damaging 1.00
R2046:Arid2 UTSW 15 96369387 missense probably damaging 1.00
R2069:Arid2 UTSW 15 96362590 missense probably damaging 1.00
R2149:Arid2 UTSW 15 96370835 missense probably damaging 1.00
R2300:Arid2 UTSW 15 96402006 missense probably damaging 1.00
R2336:Arid2 UTSW 15 96362549 missense probably damaging 1.00
R2359:Arid2 UTSW 15 96361878 missense probably damaging 1.00
R2368:Arid2 UTSW 15 96350012 missense possibly damaging 0.83
R2829:Arid2 UTSW 15 96369454 missense possibly damaging 0.95
R3013:Arid2 UTSW 15 96361936 missense probably damaging 1.00
R3109:Arid2 UTSW 15 96356746 missense probably damaging 1.00
R3765:Arid2 UTSW 15 96370714 missense probably benign 0.01
R3785:Arid2 UTSW 15 96372558 missense possibly damaging 0.83
R3811:Arid2 UTSW 15 96289086 missense probably benign 0.01
R3812:Arid2 UTSW 15 96289086 missense probably benign 0.01
R3813:Arid2 UTSW 15 96369950 missense probably benign 0.26
R3843:Arid2 UTSW 15 96351840 missense possibly damaging 0.86
R3978:Arid2 UTSW 15 96363622 missense probably damaging 1.00
R4279:Arid2 UTSW 15 96371756 missense probably damaging 1.00
R4569:Arid2 UTSW 15 96392462 missense probably damaging 1.00
R4597:Arid2 UTSW 15 96370856 missense probably damaging 1.00
R5020:Arid2 UTSW 15 96371988 missense probably damaging 0.96
R5154:Arid2 UTSW 15 96401985 missense probably damaging 1.00
R5303:Arid2 UTSW 15 96392468 missense probably damaging 1.00
R5620:Arid2 UTSW 15 96372506 missense probably benign 0.20
R5766:Arid2 UTSW 15 96372205 missense probably benign 0.01
R6005:Arid2 UTSW 15 96370972 missense probably benign
R6169:Arid2 UTSW 15 96368677 missense probably benign 0.36
R6216:Arid2 UTSW 15 96356909 missense probably benign 0.18
R6392:Arid2 UTSW 15 96361602 missense probably damaging 0.99
R6430:Arid2 UTSW 15 96363694 missense probably benign
R6454:Arid2 UTSW 15 96372413 missense probably benign 0.20
R6672:Arid2 UTSW 15 96362345 missense probably benign 0.30
R6985:Arid2 UTSW 15 96370148 missense probably benign 0.06
R7132:Arid2 UTSW 15 96350013 missense possibly damaging 0.67
R7133:Arid2 UTSW 15 96378875 missense probably damaging 0.99
R7453:Arid2 UTSW 15 96370724 missense probably benign
R7562:Arid2 UTSW 15 96401968 missense probably damaging 1.00
R7594:Arid2 UTSW 15 96390994 missense probably damaging 1.00
R7692:Arid2 UTSW 15 96356697 nonsense probably null
R7792:Arid2 UTSW 15 96369375 missense probably benign 0.05
R8036:Arid2 UTSW 15 96368744 missense probably damaging 1.00
X0024:Arid2 UTSW 15 96372490 missense probably benign 0.00
X0066:Arid2 UTSW 15 96356804 missense probably damaging 1.00
Z1177:Arid2 UTSW 15 96390986 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTAGTGATTGTGAGCCAGCC -3'
(R):5'- TTGATGAGACTAGACTCGTTGG -3'

Sequencing Primer
(F):5'- ATTGTGAGCCAGCCAGCAC -3'
(R):5'- CTGAACTTGCACCTGGACCTG -3'
Posted On2018-08-29