Incidental Mutation 'R6776:Vdr'
ID531319
Institutional Source Beutler Lab
Gene Symbol Vdr
Ensembl Gene ENSMUSG00000022479
Gene Namevitamin D (1,25-dihydroxyvitamin D3) receptor
SynonymsNr1i1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6776 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location97854425-97910630 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97869828 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 94 (I94V)
Ref Sequence ENSEMBL: ENSMUSP00000023119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023119]
Predicted Effect probably damaging
Transcript: ENSMUST00000023119
AA Change: I94V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023119
Gene: ENSMUSG00000022479
AA Change: I94V

DomainStartEndE-ValueType
ZnF_C4 21 92 1.4e-34 SMART
low complexity region 102 114 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
HOLI 227 389 3.54e-36 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the nuclear hormone receptor for vitamin D3. This receptor also functions as a receptor for the secondary bile acid lithocholic acid. The receptor belongs to the family of trans-acting transcriptional regulatory factors and shows sequence similarity to the steroid and thyroid hormone receptors. Downstream targets of this nuclear hormone receptor are principally involved in mineral metabolism though the receptor regulates a variety of other metabolic pathways, such as those involved in the immune response and cancer. Mutations in this gene are associated with type II vitamin D-resistant rickets. A single nucleotide polymorphism in the initiation codon results in an alternate translation start site three codons downstream. Alternative splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mutants fail to thrive after weaning and may exhibit excess mortality. Postweaning mutant mice develop alopecia, hypocalcemia, infertility, and rickets. Mutant females exhibit uterine hypoplasia with impaired follicular development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik C A 1: 43,742,391 N144K probably damaging Het
2900011O08Rik T A 16: 13,986,806 S6T possibly damaging Het
Abhd13 A G 8: 9,988,075 H224R probably benign Het
Anapc10 T C 8: 79,719,745 F68S probably damaging Het
Arid2 A G 15: 96,370,949 N981S probably benign Het
BC055324 T C 1: 163,976,749 I338M probably damaging Het
Cfap73 A G 5: 120,634,211 F9L probably damaging Het
Chd3 A C 11: 69,354,470 L1141V probably damaging Het
Daam1 C T 12: 71,989,808 L1052F possibly damaging Het
Dmxl1 C T 18: 49,893,974 R2050C probably damaging Het
Dpp10 G A 1: 123,367,656 Q552* probably null Het
Dysf A G 6: 84,064,894 D160G possibly damaging Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,965 probably benign Het
Ftcd T C 10: 76,589,239 I518T probably benign Het
Gapdh A G 6: 125,162,273 S248P probably damaging Het
Gm5592 C G 7: 41,289,729 P812A probably damaging Het
Grik2 G A 10: 49,355,989 L482F probably damaging Het
Gzmg C T 14: 56,156,831 G202D probably damaging Het
Hectd4 G A 5: 121,353,511 A3671T possibly damaging Het
Hexa G T 9: 59,558,072 W203C probably damaging Het
Igdcc4 A T 9: 65,135,418 T1217S probably benign Het
Ipo7 A G 7: 110,047,065 D557G probably damaging Het
Irx3 T A 8: 91,799,835 T414S probably benign Het
Jakmip1 G A 5: 37,187,154 E1313K probably damaging Het
Kbtbd12 T C 6: 88,618,266 D194G probably damaging Het
Klk6 T C 7: 43,826,874 L46P probably damaging Het
Krt86 T C 15: 101,476,936 I329T probably benign Het
Mroh5 A G 15: 73,789,968 probably null Het
Mtrf1 T C 14: 79,413,081 V323A probably damaging Het
Oas3 A T 5: 120,758,874 I894N probably damaging Het
Oplah C T 15: 76,300,853 V887I possibly damaging Het
Pag1 T C 3: 9,699,788 T102A probably benign Het
Pcnx C T 12: 81,962,722 A1181V possibly damaging Het
Pkdrej G T 15: 85,817,309 Y1475* probably null Het
Pla2g5 A G 4: 138,800,653 S101P probably benign Het
Plekha4 C A 7: 45,534,817 A76E probably damaging Het
Plk2 T C 13: 110,399,791 I592T probably benign Het
Ppp2r3a A T 9: 101,212,862 H87Q probably benign Het
Ppp2r3c T A 12: 55,298,467 R79* probably null Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Prrt4 G T 6: 29,176,552 T258K possibly damaging Het
Rhpn2 T A 7: 35,383,769 probably null Het
Slc11a1 T A 1: 74,384,085 I365N probably damaging Het
Slc7a7 C T 14: 54,374,651 G265D possibly damaging Het
Thsd7a T A 6: 12,555,637 T83S possibly damaging Het
Tln2 A G 9: 67,262,905 S1989P probably damaging Het
Tnfaip3 T G 10: 19,005,576 T321P probably benign Het
Tnrc6b C T 15: 80,924,119 P1623L possibly damaging Het
Trpa1 T C 1: 14,912,377 N85S probably benign Het
Trrap C T 5: 144,851,256 R3544* probably null Het
Ttf2 A T 3: 100,952,553 V695E probably benign Het
Ttll4 A G 1: 74,681,353 E509G probably damaging Het
Wdfy3 G T 5: 101,884,045 Q2304K possibly damaging Het
Zfp663 T C 2: 165,359,015 Y33C probably damaging Het
Other mutations in Vdr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Vdr APN 15 97884854 missense probably damaging 1.00
IGL02813:Vdr APN 15 97869681 missense probably benign 0.45
yangshuo UTSW 15 97859121 missense probably damaging 1.00
R0400:Vdr UTSW 15 97869351 missense probably benign 0.00
R1102:Vdr UTSW 15 97859121 missense probably damaging 1.00
R1172:Vdr UTSW 15 97869333 missense probably benign 0.05
R1173:Vdr UTSW 15 97869333 missense probably benign 0.05
R1268:Vdr UTSW 15 97857475 missense probably benign 0.39
R1705:Vdr UTSW 15 97867171 missense probably damaging 1.00
R2879:Vdr UTSW 15 97859127 missense probably benign 0.01
R3030:Vdr UTSW 15 97857563 missense probably benign 0.00
R4695:Vdr UTSW 15 97858920 splice site probably null
R5074:Vdr UTSW 15 97857578 missense probably benign 0.35
R5710:Vdr UTSW 15 97859127 missense probably damaging 1.00
R5710:Vdr UTSW 15 97867208 missense probably benign 0.02
R5845:Vdr UTSW 15 97869766 missense possibly damaging 0.46
R5982:Vdr UTSW 15 97857596 missense probably benign 0.37
R6865:Vdr UTSW 15 97857505 missense probably damaging 1.00
R7870:Vdr UTSW 15 97884890 missense possibly damaging 0.59
R7953:Vdr UTSW 15 97884890 missense possibly damaging 0.59
X0023:Vdr UTSW 15 97869818 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGATTCTCCACTAGCCTGG -3'
(R):5'- TCGCTGTAGAAAACCGGGTTG -3'

Sequencing Primer
(F):5'- TAGCCTGGTTCAAGCCACAG -3'
(R):5'- AAAACCGGGTTGTCTCCATG -3'
Posted On2018-08-29