Incidental Mutation 'R6776:Prpf40b'
List |< first << previous [record 40 of 55] next >> last >|
ID531320
Institutional Source Beutler Lab
Gene Symbol Prpf40b
Ensembl Gene ENSMUSG00000023007
Gene Namepre-mRNA processing factor 40B
Synonyms2610317D23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R6776 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location99295087-99317018 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 99314903 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 627 (R627W)
Ref Sequence ENSEMBL: ENSMUSP00000023745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023745] [ENSMUST00000081224] [ENSMUST00000088233] [ENSMUST00000118287] [ENSMUST00000120633] [ENSMUST00000126955] [ENSMUST00000136980] [ENSMUST00000145482] [ENSMUST00000150636]
Predicted Effect probably damaging
Transcript: ENSMUST00000023745
AA Change: R627W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023745
Gene: ENSMUSG00000023007
AA Change: R627W

DomainStartEndE-ValueType
low complexity region 1 24 N/A INTRINSIC
low complexity region 28 52 N/A INTRINSIC
low complexity region 56 87 N/A INTRINSIC
WW 93 125 7.6e-9 SMART
WW 134 166 1.75e-8 SMART
low complexity region 182 212 N/A INTRINSIC
low complexity region 255 267 N/A INTRINSIC
FF 276 330 2.36e-14 SMART
FF 410 470 6.94e-3 SMART
FF 490 550 1.41e0 SMART
low complexity region 557 568 N/A INTRINSIC
FF 626 682 3.41e-11 SMART
low complexity region 693 776 N/A INTRINSIC
low complexity region 777 796 N/A INTRINSIC
low complexity region 809 825 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081224
SMART Domains Protein: ENSMUSP00000079984
Gene: ENSMUSG00000023008

DomainStartEndE-ValueType
Drf_GBD 26 227 2.99e-88 SMART
Drf_FH3 230 421 6.1e-71 SMART
low complexity region 448 497 N/A INTRINSIC
FH2 510 944 9.85e-141 SMART
low complexity region 960 975 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088233
SMART Domains Protein: ENSMUSP00000085566
Gene: ENSMUSG00000023008

DomainStartEndE-ValueType
Drf_GBD 26 278 3.91e-92 SMART
Drf_FH3 281 472 6.1e-71 SMART
low complexity region 499 548 N/A INTRINSIC
FH2 561 995 9.85e-141 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118287
AA Change: R627W

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113282
Gene: ENSMUSG00000023007
AA Change: R627W

DomainStartEndE-ValueType
low complexity region 1 24 N/A INTRINSIC
low complexity region 28 52 N/A INTRINSIC
low complexity region 56 87 N/A INTRINSIC
WW 93 125 7.6e-9 SMART
WW 134 166 1.75e-8 SMART
low complexity region 182 212 N/A INTRINSIC
low complexity region 255 267 N/A INTRINSIC
FF 276 330 2.36e-14 SMART
FF 410 470 6.94e-3 SMART
FF 490 550 1.41e0 SMART
low complexity region 557 568 N/A INTRINSIC
FF 626 682 3.41e-11 SMART
low complexity region 694 777 N/A INTRINSIC
low complexity region 778 797 N/A INTRINSIC
low complexity region 810 826 N/A INTRINSIC
low complexity region 845 866 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120633
SMART Domains Protein: ENSMUSP00000113094
Gene: ENSMUSG00000023008

DomainStartEndE-ValueType
Drf_GBD 26 278 3.91e-92 SMART
Drf_FH3 281 472 6.1e-71 SMART
low complexity region 499 548 N/A INTRINSIC
FH2 561 995 9.85e-141 SMART
low complexity region 1011 1026 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124275
Predicted Effect probably benign
Transcript: ENSMUST00000126955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130575
Predicted Effect unknown
Transcript: ENSMUST00000134034
AA Change: R9W
SMART Domains Protein: ENSMUSP00000120030
Gene: ENSMUSG00000023007
AA Change: R9W

DomainStartEndE-ValueType
Pfam:FF 11 62 2.2e-7 PFAM
low complexity region 77 92 N/A INTRINSIC
low complexity region 103 164 N/A INTRINSIC
low complexity region 165 184 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 232 253 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136980
AA Change: R614W

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122649
Gene: ENSMUSG00000023007
AA Change: R614W

DomainStartEndE-ValueType
low complexity region 1 18 N/A INTRINSIC
low complexity region 22 46 N/A INTRINSIC
low complexity region 50 81 N/A INTRINSIC
WW 87 119 7.6e-9 SMART
WW 128 160 1.75e-8 SMART
low complexity region 176 206 N/A INTRINSIC
low complexity region 249 261 N/A INTRINSIC
FF 270 324 2.36e-14 SMART
FF 404 464 6.94e-3 SMART
FF 484 544 1.41e0 SMART
FF 613 669 3.41e-11 SMART
low complexity region 681 764 N/A INTRINSIC
low complexity region 765 784 N/A INTRINSIC
low complexity region 797 813 N/A INTRINSIC
low complexity region 832 853 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139330
Predicted Effect probably damaging
Transcript: ENSMUST00000145482
AA Change: R627W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115869
Gene: ENSMUSG00000023007
AA Change: R627W

DomainStartEndE-ValueType
low complexity region 1 24 N/A INTRINSIC
low complexity region 28 52 N/A INTRINSIC
low complexity region 56 87 N/A INTRINSIC
WW 93 125 7.6e-9 SMART
WW 134 166 1.75e-8 SMART
low complexity region 182 212 N/A INTRINSIC
low complexity region 255 267 N/A INTRINSIC
FF 276 330 2.36e-14 SMART
FF 410 470 6.94e-3 SMART
FF 490 550 1.41e0 SMART
low complexity region 557 568 N/A INTRINSIC
FF 626 682 3.41e-11 SMART
low complexity region 693 708 N/A INTRINSIC
low complexity region 719 780 N/A INTRINSIC
low complexity region 781 800 N/A INTRINSIC
low complexity region 813 829 N/A INTRINSIC
low complexity region 848 869 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150636
SMART Domains Protein: ENSMUSP00000119295
Gene: ENSMUSG00000023007

DomainStartEndE-ValueType
Pfam:FF 1 52 1.2e-7 PFAM
low complexity region 67 82 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150641
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153692
Meta Mutation Damage Score 0.4298 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WW-domain containing protein similar to yeast splicing factor PRP40. This protein has been shown to interact with Huntingtin and methyl CpG binding protein 2 (MeCP2). Alternative splicing results in different transcript variants. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik C A 1: 43,742,391 N144K probably damaging Het
2900011O08Rik T A 16: 13,986,806 S6T possibly damaging Het
Abhd13 A G 8: 9,988,075 H224R probably benign Het
Anapc10 T C 8: 79,719,745 F68S probably damaging Het
Arid2 A G 15: 96,370,949 N981S probably benign Het
BC055324 T C 1: 163,976,749 I338M probably damaging Het
Cfap73 A G 5: 120,634,211 F9L probably damaging Het
Chd3 A C 11: 69,354,470 L1141V probably damaging Het
Daam1 C T 12: 71,989,808 L1052F possibly damaging Het
Dmxl1 C T 18: 49,893,974 R2050C probably damaging Het
Dpp10 G A 1: 123,367,656 Q552* probably null Het
Dysf A G 6: 84,064,894 D160G possibly damaging Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,965 probably benign Het
Ftcd T C 10: 76,589,239 I518T probably benign Het
Gapdh A G 6: 125,162,273 S248P probably damaging Het
Gm5592 C G 7: 41,289,729 P812A probably damaging Het
Grik2 G A 10: 49,355,989 L482F probably damaging Het
Gzmg C T 14: 56,156,831 G202D probably damaging Het
Hectd4 G A 5: 121,353,511 A3671T possibly damaging Het
Hexa G T 9: 59,558,072 W203C probably damaging Het
Igdcc4 A T 9: 65,135,418 T1217S probably benign Het
Ipo7 A G 7: 110,047,065 D557G probably damaging Het
Irx3 T A 8: 91,799,835 T414S probably benign Het
Jakmip1 G A 5: 37,187,154 E1313K probably damaging Het
Kbtbd12 T C 6: 88,618,266 D194G probably damaging Het
Klk6 T C 7: 43,826,874 L46P probably damaging Het
Krt86 T C 15: 101,476,936 I329T probably benign Het
Mroh5 A G 15: 73,789,968 probably null Het
Mtrf1 T C 14: 79,413,081 V323A probably damaging Het
Oas3 A T 5: 120,758,874 I894N probably damaging Het
Oplah C T 15: 76,300,853 V887I possibly damaging Het
Pag1 T C 3: 9,699,788 T102A probably benign Het
Pcnx C T 12: 81,962,722 A1181V possibly damaging Het
Pkdrej G T 15: 85,817,309 Y1475* probably null Het
Pla2g5 A G 4: 138,800,653 S101P probably benign Het
Plekha4 C A 7: 45,534,817 A76E probably damaging Het
Plk2 T C 13: 110,399,791 I592T probably benign Het
Ppp2r3a A T 9: 101,212,862 H87Q probably benign Het
Ppp2r3c T A 12: 55,298,467 R79* probably null Het
Prrt4 G T 6: 29,176,552 T258K possibly damaging Het
Rhpn2 T A 7: 35,383,769 probably null Het
Slc11a1 T A 1: 74,384,085 I365N probably damaging Het
Slc7a7 C T 14: 54,374,651 G265D possibly damaging Het
Thsd7a T A 6: 12,555,637 T83S possibly damaging Het
Tln2 A G 9: 67,262,905 S1989P probably damaging Het
Tnfaip3 T G 10: 19,005,576 T321P probably benign Het
Tnrc6b C T 15: 80,924,119 P1623L possibly damaging Het
Trpa1 T C 1: 14,912,377 N85S probably benign Het
Trrap C T 5: 144,851,256 R3544* probably null Het
Ttf2 A T 3: 100,952,553 V695E probably benign Het
Ttll4 A G 1: 74,681,353 E509G probably damaging Het
Vdr T C 15: 97,869,828 I94V probably damaging Het
Wdfy3 G T 5: 101,884,045 Q2304K possibly damaging Het
Zfp663 T C 2: 165,359,015 Y33C probably damaging Het
Other mutations in Prpf40b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00688:Prpf40b APN 15 99316131 missense probably benign 0.04
IGL00821:Prpf40b APN 15 99316501 missense probably benign 0.04
IGL00949:Prpf40b APN 15 99306538 missense probably benign 0.00
IGL01621:Prpf40b APN 15 99310045 unclassified probably benign
IGL01816:Prpf40b APN 15 99315218 missense probably damaging 1.00
IGL01878:Prpf40b APN 15 99306532 missense possibly damaging 0.84
IGL01886:Prpf40b APN 15 99304447 missense unknown
IGL02025:Prpf40b APN 15 99314588 missense probably damaging 1.00
IGL02440:Prpf40b APN 15 99306866 missense probably damaging 0.98
R0101:Prpf40b UTSW 15 99306800 splice site probably benign
R0284:Prpf40b UTSW 15 99316393 splice site probably benign
R0356:Prpf40b UTSW 15 99305199 splice site probably null
R0602:Prpf40b UTSW 15 99304471 missense unknown
R0632:Prpf40b UTSW 15 99316289 missense probably benign 0.04
R1220:Prpf40b UTSW 15 99316348 missense probably benign 0.10
R1660:Prpf40b UTSW 15 99305561 missense probably damaging 1.00
R2224:Prpf40b UTSW 15 99303291 start gained probably benign
R2245:Prpf40b UTSW 15 99305166 intron probably benign
R2342:Prpf40b UTSW 15 99306168 missense probably damaging 0.98
R4019:Prpf40b UTSW 15 99316476 missense probably benign 0.10
R4449:Prpf40b UTSW 15 99314663 missense probably damaging 1.00
R4622:Prpf40b UTSW 15 99316316 missense probably benign 0.01
R4869:Prpf40b UTSW 15 99309845 intron probably benign
R5960:Prpf40b UTSW 15 99314904 missense probably damaging 1.00
R6734:Prpf40b UTSW 15 99314903 missense probably damaging 1.00
R6735:Prpf40b UTSW 15 99314903 missense probably damaging 1.00
R6783:Prpf40b UTSW 15 99314903 missense probably damaging 1.00
R7025:Prpf40b UTSW 15 99306400 nonsense probably null
R7544:Prpf40b UTSW 15 99306018 missense probably benign 0.01
R7733:Prpf40b UTSW 15 99308343 critical splice donor site probably null
X0019:Prpf40b UTSW 15 99307703 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGTGGTCCTCTCACTTAC -3'
(R):5'- AGAGCACTGCTGATCAGACC -3'

Sequencing Primer
(F):5'- GTGGTCCTCTCACTTACCCCAATG -3'
(R):5'- ACTGCTGATCAGACCAGGCC -3'
Posted On2018-08-29