Incidental Mutation 'R6777:Capn2'
ID531326
Institutional Source Beutler Lab
Gene Symbol Capn2
Ensembl Gene ENSMUSG00000026509
Gene Namecalpain 2
SynonymsCapa-2, Capa2, m-calpain
MMRRC Submission
Accession Numbers

Genbank: NM_009794 ; MGI: 88264

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6777 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location182467260-182517608 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 182470177 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000068895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068505]
Predicted Effect probably null
Transcript: ENSMUST00000068505
SMART Domains Protein: ENSMUSP00000068895
Gene: ENSMUSG00000026509

DomainStartEndE-ValueType
CysPc 27 352 1.62e-186 SMART
calpain_III 355 510 3.47e-90 SMART
low complexity region 513 532 N/A INTRINSIC
EFh 576 604 5.86e0 SMART
EFh 606 634 3.21e0 SMART
Meta Mutation Damage Score 0.9576 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The calpains, calcium-activated neutral proteases, are nonlysosomal, intracellular cysteine proteases. The mammalian calpains include ubiquitous, stomach-specific, and muscle-specific proteins. The ubiquitous enzymes consist of heterodimers with distinct large, catalytic subunits associated with a common small, regulatory subunit. This gene encodes the large subunit of the ubiquitous enzyme, calpain 2. Multiple heterogeneous transcriptional start sites in the 5' UTR have been reported. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous inactivation of this gene leads to complete prenatal lethality. Mice homozygous for one null allele display placental dysfunction, thin ventricular walls, and peripheral vessel failure. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik A T 7: 12,512,829 L45F probably benign Het
Adam7 T C 14: 68,525,335 Y147C probably damaging Het
Adss A T 1: 177,776,336 probably null Het
Atp2c1 T A 9: 105,418,600 I812L possibly damaging Het
Crybg3 A G 16: 59,558,315 probably benign Het
Cux1 C G 5: 136,565,568 probably benign Het
Dkk2 T A 3: 132,173,811 C84S probably damaging Het
Eml3 T C 19: 8,936,722 V128A probably benign Het
Fzr1 A G 10: 81,370,493 Y148H probably damaging Het
Galnt9 G A 5: 110,620,599 R587H probably damaging Het
Ganc A G 2: 120,444,149 T584A probably damaging Het
Gldc T C 19: 30,133,512 T564A probably damaging Het
Gm49359 A T 13: 62,455,192 C65S probably benign Het
Hspa12a A G 19: 58,822,087 Y175H probably benign Het
Ly6g A G 15: 75,158,582 D60G probably benign Het
Olfr736 A T 14: 50,393,658 M301L probably damaging Het
Pex1 T A 5: 3,622,358 C694S probably benign Het
Pkd1l3 T C 8: 109,626,814 F676L probably benign Het
Pla2g2c T C 4: 138,743,665 V119A probably benign Het
Ralgps2 A G 1: 156,887,945 probably null Het
Rbp3 C A 14: 33,954,273 H59Q probably benign Het
Serpina3c T C 12: 104,151,810 K90E probably benign Het
Slc24a3 A G 2: 145,640,282 Y620C probably damaging Het
Smg1 C A 7: 118,189,117 probably benign Het
Srp68 A T 11: 116,262,904 V198E probably damaging Het
Ssx2ip C T 3: 146,438,721 T580M possibly damaging Het
Tcrg-V3 A G 13: 19,243,280 Y111C probably damaging Het
Terf2 A G 8: 107,070,537 V434A possibly damaging Het
Tmem242 G A 17: 5,433,555 P71S probably damaging Het
Tmprss13 C T 9: 45,336,101 R254* probably null Het
Other mutations in Capn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02049:Capn2 APN 1 182473954 splice site probably benign
IGL02589:Capn2 APN 1 182484348 missense probably damaging 1.00
IGL02679:Capn2 APN 1 182472584 missense probably benign
IGL03207:Capn2 APN 1 182489013 missense possibly damaging 0.92
E7848:Capn2 UTSW 1 182486594 missense possibly damaging 0.67
R0070:Capn2 UTSW 1 182473869 splice site probably benign
R0070:Capn2 UTSW 1 182473869 splice site probably benign
R0540:Capn2 UTSW 1 182492184 nonsense probably null
R0571:Capn2 UTSW 1 182470760 missense probably benign 0.01
R1620:Capn2 UTSW 1 182517137 missense probably damaging 1.00
R1818:Capn2 UTSW 1 182472597 missense probably benign 0.00
R1819:Capn2 UTSW 1 182472597 missense probably benign 0.00
R1822:Capn2 UTSW 1 182472960 missense possibly damaging 0.95
R1880:Capn2 UTSW 1 182489016 missense probably damaging 1.00
R2174:Capn2 UTSW 1 182479725 missense probably benign 0.22
R2391:Capn2 UTSW 1 182478609 missense probably benign 0.01
R2860:Capn2 UTSW 1 182472920 splice site probably benign
R2861:Capn2 UTSW 1 182472920 splice site probably benign
R2878:Capn2 UTSW 1 182517233 missense probably benign 0.00
R3052:Capn2 UTSW 1 182487772 missense probably benign 0.06
R4463:Capn2 UTSW 1 182479764 intron probably benign
R4669:Capn2 UTSW 1 182470780 missense probably benign 0.00
R5077:Capn2 UTSW 1 182472573 missense possibly damaging 0.71
R5397:Capn2 UTSW 1 182470706 missense probably damaging 1.00
R5696:Capn2 UTSW 1 182478600 missense possibly damaging 0.79
R6800:Capn2 UTSW 1 182481480 missense probably damaging 0.99
R7741:Capn2 UTSW 1 182479723 nonsense probably null
R7814:Capn2 UTSW 1 182492146 missense probably damaging 1.00
R7995:Capn2 UTSW 1 182478546 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCAAAAGAACGTCATCCTGGG -3'
(R):5'- GTGCAGTCACTGGATGTGTC -3'

Sequencing Primer
(F):5'- AACGTCATCCTGGGAGTAGC -3'
(R):5'- AATGTCCCTGTCGTTAAACTGG -3'
Posted On2018-08-29