Incidental Mutation 'R6777:Fzr1'
ID531341
Institutional Source Beutler Lab
Gene Symbol Fzr1
Ensembl Gene ENSMUSG00000020235
Gene Namefizzy and cell division cycle 20 related 1
SynonymsCdh1, Fyr
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6777 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location81366222-81378516 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81370493 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 148 (Y148H)
Ref Sequence ENSEMBL: ENSMUSP00000020457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020456] [ENSMUST00000020457] [ENSMUST00000044844] [ENSMUST00000118812] [ENSMUST00000140901]
Predicted Effect probably benign
Transcript: ENSMUST00000020456
SMART Domains Protein: ENSMUSP00000020456
Gene: ENSMUSG00000020234

DomainStartEndE-ValueType
Pfam:DUF4531 23 204 1.3e-113 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000020457
AA Change: Y148H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020457
Gene: ENSMUSG00000020235
AA Change: Y148H

DomainStartEndE-ValueType
Blast:WD40 172 213 8e-21 BLAST
WD40 218 257 1.2e-2 SMART
WD40 260 297 6.79e-2 SMART
WD40 302 341 3.55e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000044844
SMART Domains Protein: ENSMUSP00000036116
Gene: ENSMUSG00000034854

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:MFS_2 20 423 5.2e-43 PFAM
Pfam:MFS_1 154 416 6.8e-12 PFAM
transmembrane domain 441 463 N/A INTRINSIC
low complexity region 464 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118812
SMART Domains Protein: ENSMUSP00000112868
Gene: ENSMUSG00000020235

DomainStartEndE-ValueType
WD40 129 168 5.6e-3 SMART
WD40 171 208 6.79e-2 SMART
WD40 213 252 3.99e-8 SMART
WD40 255 297 2.84e-4 SMART
WD40 300 340 1.98e1 SMART
WD40 343 382 1.11e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000140901
AA Change: Y148H

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114203
Gene: ENSMUSG00000020235
AA Change: Y148H

DomainStartEndE-ValueType
Blast:WD40 172 213 1e-19 BLAST
WD40 218 257 1.2e-2 SMART
WD40 260 297 6.79e-2 SMART
WD40 302 341 3.99e-8 SMART
WD40 344 386 2.84e-4 SMART
WD40 389 429 1.98e1 SMART
WD40 432 471 1.11e-6 SMART
Meta Mutation Damage Score 0.3145 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 100% (32/32)
MGI Phenotype PHENOTYPE: Homozygous null mutants die embryonically at around E9.5-E12.5 with poorly developed placentae, no placental giant cells and/or erythroblast deficiency. Homozygous MEFs undergo premature senescence. Heterozygotes exhibit learning/memory defects and/or elevatedspontaneous epithelial tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik A T 7: 12,512,829 L45F probably benign Het
Adam7 T C 14: 68,525,335 Y147C probably damaging Het
Adss A T 1: 177,776,336 probably null Het
Atp2c1 T A 9: 105,418,600 I812L possibly damaging Het
Capn2 A G 1: 182,470,177 probably null Het
Crybg3 A G 16: 59,558,315 probably benign Het
Cux1 C G 5: 136,565,568 probably benign Het
Dkk2 T A 3: 132,173,811 C84S probably damaging Het
Eml3 T C 19: 8,936,722 V128A probably benign Het
Galnt9 G A 5: 110,620,599 R587H probably damaging Het
Ganc A G 2: 120,444,149 T584A probably damaging Het
Gldc T C 19: 30,133,512 T564A probably damaging Het
Gm49359 A T 13: 62,455,192 C65S probably benign Het
Hspa12a A G 19: 58,822,087 Y175H probably benign Het
Ly6g A G 15: 75,158,582 D60G probably benign Het
Olfr736 A T 14: 50,393,658 M301L probably damaging Het
Pex1 T A 5: 3,622,358 C694S probably benign Het
Pkd1l3 T C 8: 109,626,814 F676L probably benign Het
Pla2g2c T C 4: 138,743,665 V119A probably benign Het
Ralgps2 A G 1: 156,887,945 probably null Het
Rbp3 C A 14: 33,954,273 H59Q probably benign Het
Serpina3c T C 12: 104,151,810 K90E probably benign Het
Slc24a3 A G 2: 145,640,282 Y620C probably damaging Het
Smg1 C A 7: 118,189,117 probably benign Het
Srp68 A T 11: 116,262,904 V198E probably damaging Het
Ssx2ip C T 3: 146,438,721 T580M possibly damaging Het
Tcrg-V3 A G 13: 19,243,280 Y111C probably damaging Het
Terf2 A G 8: 107,070,537 V434A possibly damaging Het
Tmem242 G A 17: 5,433,555 P71S probably damaging Het
Tmprss13 C T 9: 45,336,101 R254* probably null Het
Other mutations in Fzr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Fzr1 APN 10 81370525 nonsense probably null
IGL02541:Fzr1 APN 10 81370033 missense probably damaging 0.98
IGL03327:Fzr1 APN 10 81369184 missense probably benign 0.05
IGL03346:Fzr1 APN 10 81369184 missense probably benign 0.05
PIT4445001:Fzr1 UTSW 10 81369394 nonsense probably null
R0179:Fzr1 UTSW 10 81369070 splice site probably benign
R0403:Fzr1 UTSW 10 81369368 missense possibly damaging 0.95
R1591:Fzr1 UTSW 10 81370367 missense possibly damaging 0.75
R1987:Fzr1 UTSW 10 81370319 missense probably damaging 0.98
R2358:Fzr1 UTSW 10 81367640 critical splice donor site probably null
R2844:Fzr1 UTSW 10 81369418 missense probably damaging 1.00
R4657:Fzr1 UTSW 10 81367552 critical splice acceptor site probably null
R5054:Fzr1 UTSW 10 81371419 utr 5 prime probably benign
R5108:Fzr1 UTSW 10 81369450 splice site probably benign
R5201:Fzr1 UTSW 10 81367528 missense probably damaging 1.00
R5494:Fzr1 UTSW 10 81371344 critical splice donor site probably null
R5663:Fzr1 UTSW 10 81370526 missense probably benign 0.00
R5733:Fzr1 UTSW 10 81370326 missense possibly damaging 0.95
R5997:Fzr1 UTSW 10 81370826 critical splice acceptor site probably null
R7055:Fzr1 UTSW 10 81370223 missense probably damaging 1.00
R7078:Fzr1 UTSW 10 81368629 missense probably damaging 1.00
R7883:Fzr1 UTSW 10 81368635 missense probably damaging 1.00
R7966:Fzr1 UTSW 10 81368635 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACCTTGAAGGGAATCTTAGAG -3'
(R):5'- AGCACAAGGGGCTCTTTACG -3'

Sequencing Primer
(F):5'- CTTGAAGGGAATCTTAGAGATCTTGC -3'
(R):5'- CTCTTTACGGTGAGCCAGG -3'
Posted On2018-08-29