Incidental Mutation 'R6777:Gldc'
ID 531353
Institutional Source Beutler Lab
Gene Symbol Gldc
Ensembl Gene ENSMUSG00000024827
Gene Name glycine decarboxylase
Synonyms b2b2679Clo, D030049L12Rik, D19Wsu57e
MMRRC Submission 044893-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6777 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 30075847-30152829 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30110912 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 564 (T564A)
Ref Sequence ENSEMBL: ENSMUSP00000025778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025778]
AlphaFold Q91W43
Predicted Effect probably damaging
Transcript: ENSMUST00000025778
AA Change: T564A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827
AA Change: T564A

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
low complexity region 33 56 N/A INTRINSIC
Pfam:GDC-P 70 493 1.1e-202 PFAM
low complexity region 504 515 N/A INTRINSIC
Pfam:GDC-P 519 798 6.5e-8 PFAM
Pfam:Beta_elim_lyase 589 745 2e-10 PFAM
Meta Mutation Damage Score 0.9034 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik A T 7: 12,246,756 (GRCm39) L45F probably benign Het
Adam7 T C 14: 68,762,784 (GRCm39) Y147C probably damaging Het
Adss2 A T 1: 177,603,902 (GRCm39) probably null Het
Atp2c1 T A 9: 105,295,799 (GRCm39) I812L possibly damaging Het
Capn2 A G 1: 182,297,742 (GRCm39) probably null Het
Crybg3 A G 16: 59,378,678 (GRCm39) probably benign Het
Cux1 C G 5: 136,594,422 (GRCm39) probably benign Het
Dkk2 T A 3: 131,879,572 (GRCm39) C84S probably damaging Het
Eml3 T C 19: 8,914,086 (GRCm39) V128A probably benign Het
Fzr1 A G 10: 81,206,327 (GRCm39) Y148H probably damaging Het
Galnt9 G A 5: 110,768,465 (GRCm39) R587H probably damaging Het
Ganc A G 2: 120,274,630 (GRCm39) T584A probably damaging Het
Gm49359 A T 13: 62,603,006 (GRCm39) C65S probably benign Het
Hspa12a A G 19: 58,810,519 (GRCm39) Y175H probably benign Het
Ly6g A G 15: 75,030,431 (GRCm39) D60G probably benign Het
Or11j4 A T 14: 50,631,115 (GRCm39) M301L probably damaging Het
Pex1 T A 5: 3,672,358 (GRCm39) C694S probably benign Het
Pkd1l3 T C 8: 110,353,446 (GRCm39) F676L probably benign Het
Pla2g2c T C 4: 138,470,976 (GRCm39) V119A probably benign Het
Ralgps2 A G 1: 156,715,515 (GRCm39) probably null Het
Rbp3 C A 14: 33,676,230 (GRCm39) H59Q probably benign Het
Serpina3c T C 12: 104,118,069 (GRCm39) K90E probably benign Het
Slc24a3 A G 2: 145,482,202 (GRCm39) Y620C probably damaging Het
Smg1 C A 7: 117,788,340 (GRCm39) probably benign Het
Srp68 A T 11: 116,153,730 (GRCm39) V198E probably damaging Het
Ssx2ip C T 3: 146,144,476 (GRCm39) T580M possibly damaging Het
Terf2 A G 8: 107,797,169 (GRCm39) V434A possibly damaging Het
Tmem242 G A 17: 5,483,830 (GRCm39) P71S probably damaging Het
Tmprss13 C T 9: 45,247,399 (GRCm39) R254* probably null Het
Trgv3 A G 13: 19,427,450 (GRCm39) Y111C probably damaging Het
Other mutations in Gldc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Gldc APN 19 30,092,640 (GRCm39) missense probably damaging 1.00
IGL01016:Gldc APN 19 30,110,893 (GRCm39) missense possibly damaging 0.93
IGL01112:Gldc APN 19 30,135,913 (GRCm39) critical splice donor site probably null
IGL01510:Gldc APN 19 30,091,121 (GRCm39) critical splice donor site probably null
IGL01516:Gldc APN 19 30,076,432 (GRCm39) missense probably damaging 1.00
IGL01598:Gldc APN 19 30,111,156 (GRCm39) missense probably damaging 1.00
IGL01646:Gldc APN 19 30,078,165 (GRCm39) missense possibly damaging 0.61
IGL02024:Gldc APN 19 30,078,227 (GRCm39) missense probably damaging 1.00
IGL02125:Gldc APN 19 30,124,641 (GRCm39) missense probably benign 0.03
IGL02548:Gldc APN 19 30,077,299 (GRCm39) missense probably benign
IGL02711:Gldc APN 19 30,122,546 (GRCm39) critical splice donor site probably null
IGL02818:Gldc APN 19 30,113,909 (GRCm39) missense probably damaging 0.99
IGL02982:Gldc APN 19 30,122,545 (GRCm39) critical splice donor site probably null
IGL03165:Gldc APN 19 30,076,393 (GRCm39) missense possibly damaging 0.61
jojoba UTSW 19 30,110,912 (GRCm39) missense probably damaging 1.00
miserable UTSW 19 30,128,936 (GRCm39) missense probably damaging 1.00
Urchin UTSW 19 30,096,002 (GRCm39) missense probably damaging 0.98
I2289:Gldc UTSW 19 30,124,576 (GRCm39) nonsense probably null
R0180:Gldc UTSW 19 30,078,217 (GRCm39) missense possibly damaging 0.95
R0269:Gldc UTSW 19 30,096,002 (GRCm39) missense probably damaging 0.98
R0277:Gldc UTSW 19 30,093,851 (GRCm39) missense possibly damaging 0.84
R1085:Gldc UTSW 19 30,128,828 (GRCm39) missense probably damaging 1.00
R1159:Gldc UTSW 19 30,138,162 (GRCm39) intron probably benign
R1500:Gldc UTSW 19 30,091,225 (GRCm39) missense possibly damaging 0.88
R1507:Gldc UTSW 19 30,096,038 (GRCm39) missense probably damaging 1.00
R1592:Gldc UTSW 19 30,138,077 (GRCm39) intron probably benign
R1593:Gldc UTSW 19 30,091,150 (GRCm39) missense probably damaging 1.00
R1675:Gldc UTSW 19 30,120,853 (GRCm39) missense probably damaging 1.00
R1869:Gldc UTSW 19 30,116,732 (GRCm39) missense probably benign
R1965:Gldc UTSW 19 30,114,513 (GRCm39) nonsense probably null
R2312:Gldc UTSW 19 30,078,226 (GRCm39) missense probably damaging 0.98
R2425:Gldc UTSW 19 30,109,190 (GRCm39) missense probably damaging 1.00
R3836:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R3837:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R3839:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R4191:Gldc UTSW 19 30,123,058 (GRCm39) missense probably damaging 0.96
R4380:Gldc UTSW 19 30,138,168 (GRCm39) intron probably benign
R4508:Gldc UTSW 19 30,120,807 (GRCm39) missense probably damaging 1.00
R4570:Gldc UTSW 19 30,151,839 (GRCm39) missense probably benign
R4655:Gldc UTSW 19 30,138,102 (GRCm39) intron probably benign
R4842:Gldc UTSW 19 30,111,132 (GRCm39) missense possibly damaging 0.94
R5070:Gldc UTSW 19 30,095,998 (GRCm39) missense possibly damaging 0.84
R5085:Gldc UTSW 19 30,128,936 (GRCm39) missense probably damaging 1.00
R5268:Gldc UTSW 19 30,123,125 (GRCm39) missense probably damaging 0.96
R5368:Gldc UTSW 19 30,135,921 (GRCm39) missense probably benign
R5718:Gldc UTSW 19 30,088,172 (GRCm39) nonsense probably null
R5878:Gldc UTSW 19 30,120,867 (GRCm39) splice site probably null
R6192:Gldc UTSW 19 30,111,172 (GRCm39) missense probably damaging 0.98
R6453:Gldc UTSW 19 30,093,917 (GRCm39) missense probably damaging 0.99
R6865:Gldc UTSW 19 30,111,162 (GRCm39) missense possibly damaging 0.92
R7332:Gldc UTSW 19 30,093,926 (GRCm39) missense probably damaging 0.99
R7390:Gldc UTSW 19 30,077,314 (GRCm39) missense possibly damaging 0.46
R7647:Gldc UTSW 19 30,096,067 (GRCm39) missense probably damaging 0.96
R8081:Gldc UTSW 19 30,135,987 (GRCm39) frame shift probably null
R8171:Gldc UTSW 19 30,111,161 (GRCm39) missense probably benign 0.24
R8321:Gldc UTSW 19 30,120,807 (GRCm39) nonsense probably null
R8374:Gldc UTSW 19 30,114,594 (GRCm39) missense probably damaging 1.00
R8503:Gldc UTSW 19 30,077,254 (GRCm39) missense probably benign 0.26
R8510:Gldc UTSW 19 30,093,905 (GRCm39) missense probably damaging 1.00
R8785:Gldc UTSW 19 30,092,634 (GRCm39) missense probably damaging 1.00
R8818:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8820:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8829:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8830:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8859:Gldc UTSW 19 30,116,779 (GRCm39) missense probably damaging 1.00
R8887:Gldc UTSW 19 30,111,156 (GRCm39) missense possibly damaging 0.94
R8935:Gldc UTSW 19 30,109,093 (GRCm39) missense probably benign 0.00
R8940:Gldc UTSW 19 30,128,884 (GRCm39) missense probably benign
R9070:Gldc UTSW 19 30,080,404 (GRCm39) missense probably damaging 1.00
R9100:Gldc UTSW 19 30,077,314 (GRCm39) missense possibly damaging 0.81
R9144:Gldc UTSW 19 30,114,593 (GRCm39) missense
R9163:Gldc UTSW 19 30,111,686 (GRCm39) missense probably benign 0.13
R9429:Gldc UTSW 19 30,091,172 (GRCm39) missense possibly damaging 0.88
Z1177:Gldc UTSW 19 30,123,148 (GRCm39) missense possibly damaging 0.61
Z1177:Gldc UTSW 19 30,088,179 (GRCm39) missense probably damaging 0.99
Z1177:Gldc UTSW 19 30,088,178 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGAGAAATATCAGGGTCTCTGC -3'
(R):5'- TCGTTCACAGCATGATCCCAC -3'

Sequencing Primer
(F):5'- AATATCAGGGTCTCTGCCACGATTG -3'
(R):5'- TTCACAGCATGATCCCACTGGTAG -3'
Posted On 2018-08-29