Incidental Mutation 'R6778:Sgk3'
ID531355
Institutional Source Beutler Lab
Gene Symbol Sgk3
Ensembl Gene ENSMUSG00000025915
Gene Nameserum/glucocorticoid regulated kinase 3
Synonyms2510015P22Rik, cytokine-independent survival kinase, fy, Cisk, A330005P07Rik
MMRRC Submission
Accession Numbers

Genbank: NM_133220; MGI: 2182368

Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock #R6778 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location9798107-9900845 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 9886144 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097826] [ENSMUST00000166384] [ENSMUST00000168907] [ENSMUST00000171265] [ENSMUST00000188298] [ENSMUST00000188738] [ENSMUST00000188782]
Predicted Effect probably null
Transcript: ENSMUST00000097826
SMART Domains Protein: ENSMUSP00000095437
Gene: ENSMUSG00000025915

DomainStartEndE-ValueType
PX 13 120 3.9e-19 SMART
S_TKc 162 419 1.07e-105 SMART
S_TK_X 420 489 1.96e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000166384
SMART Domains Protein: ENSMUSP00000130078
Gene: ENSMUSG00000025915

DomainStartEndE-ValueType
PX 13 120 3.9e-19 SMART
S_TKc 162 419 1.07e-105 SMART
S_TK_X 420 489 1.96e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000168907
SMART Domains Protein: ENSMUSP00000126861
Gene: ENSMUSG00000025915

DomainStartEndE-ValueType
PX 13 120 3.9e-19 SMART
S_TKc 162 419 1.07e-105 SMART
S_TK_X 420 489 1.96e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000171265
SMART Domains Protein: ENSMUSP00000127462
Gene: ENSMUSG00000025915

DomainStartEndE-ValueType
PX 13 120 3.9e-19 SMART
S_TKc 162 419 1.07e-105 SMART
S_TK_X 420 489 1.96e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188298
SMART Domains Protein: ENSMUSP00000139942
Gene: ENSMUSG00000025915

DomainStartEndE-ValueType
Pfam:PX 11 66 4.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188738
SMART Domains Protein: ENSMUSP00000140496
Gene: ENSMUSG00000025915

DomainStartEndE-ValueType
PX 13 120 2.4e-21 SMART
S_TKc 162 333 2.1e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188782
SMART Domains Protein: ENSMUSP00000140318
Gene: ENSMUSG00000025915

DomainStartEndE-ValueType
PX 13 120 2.4e-21 SMART
S_TKc 162 343 4.3e-9 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutations in this gene result in wavy vibrissae and coat/ hair abnormalities, including sparse and waved hair, due to impaired hair follicle development and/or hair cycle defects. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted, knock-out(2) Gene trapped(7) Spontaneous(7)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts14 T A 10: 61,225,452 N403Y probably damaging Het
Akap6 A G 12: 53,025,816 E989G probably damaging Het
Aoc2 A G 11: 101,325,361 N90S probably damaging Het
Apol9a T C 15: 77,404,333 Y278C probably benign Het
Casq2 T A 3: 102,127,931 probably null Het
Ccdc7a T A 8: 128,821,120 T1284S possibly damaging Het
Dlat A G 9: 50,650,857 L289P probably damaging Het
Dnah8 C T 17: 30,635,666 P101S probably benign Het
Dzip3 C A 16: 48,982,083 A28S probably benign Het
Fam205c T C 4: 42,868,522 K367R possibly damaging Het
Ffar4 A G 19: 38,113,664 E249G possibly damaging Het
Fubp3 A T 2: 31,598,673 K180N possibly damaging Het
Gm7489 T A 15: 53,885,952 probably benign Het
Ifitm6 A T 7: 141,016,143 M59K possibly damaging Het
Igkv4-80 A T 6: 69,016,561 Y115* probably null Het
Igsf21 G T 4: 140,034,648 R240S probably benign Het
Kank4 A T 4: 98,761,505 N942K probably benign Het
Man2a1 C A 17: 64,714,635 T35K possibly damaging Het
Mvk T A 5: 114,452,380 D193E probably benign Het
Npas2 T A 1: 39,325,300 M241K possibly damaging Het
Npsr1 T A 9: 24,254,618 I100N possibly damaging Het
Olfml2b A G 1: 170,645,070 D50G probably damaging Het
Olfr961 T A 9: 39,646,747 V7E probably damaging Het
Pcnx A G 12: 81,918,871 D604G probably damaging Het
Pitx2 C T 3: 129,218,743 P254L probably damaging Het
Rdh10 T C 1: 16,106,184 F56S probably damaging Het
Rin1 T C 19: 5,054,886 L647P probably damaging Het
Sgpp1 A G 12: 75,716,294 I371T probably benign Het
Slc12a9 T C 5: 137,315,081 Y872C possibly damaging Het
Syne1 A G 10: 5,102,406 F7487L probably damaging Het
Tars T C 15: 11,389,699 N375S probably benign Het
Tbc1d31 A G 15: 57,938,029 Y320C probably damaging Het
Tbl1xr1 T A 3: 22,189,782 F73L probably benign Het
Tmem145 G A 7: 25,311,376 V378I probably benign Het
Tmprss11d T C 5: 86,309,350 H150R probably benign Het
Tnc T G 4: 63,995,598 I1326L probably benign Het
Trpc7 T C 13: 56,804,687 Y502C probably damaging Het
Usp32 T C 11: 85,025,686 I811V probably benign Het
Vmn1r71 C T 7: 10,748,216 A182T probably benign Het
Wdr47 T A 3: 108,633,096 N602K probably benign Het
Other mutations in Sgk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Sgk3 APN 1 9868384 missense probably damaging 1.00
IGL00906:Sgk3 APN 1 9877245 missense probably benign 0.00
IGL01683:Sgk3 APN 1 9881866 missense probably damaging 1.00
IGL02803:Sgk3 APN 1 9879048 missense possibly damaging 0.76
woolly UTSW 1 9886104 missense probably damaging 1.00
R0034:Sgk3 UTSW 1 9885677 missense probably damaging 1.00
R0034:Sgk3 UTSW 1 9885677 missense probably damaging 1.00
R0374:Sgk3 UTSW 1 9879081 splice site probably null
R0526:Sgk3 UTSW 1 9881579 missense probably damaging 1.00
R1483:Sgk3 UTSW 1 9872293 missense possibly damaging 0.80
R1992:Sgk3 UTSW 1 9880342 missense possibly damaging 0.52
R2073:Sgk3 UTSW 1 9891424 missense probably benign 0.01
R4590:Sgk3 UTSW 1 9898795 missense possibly damaging 0.94
R5436:Sgk3 UTSW 1 9881872 missense probably damaging 1.00
R5511:Sgk3 UTSW 1 9898686 intron probably benign
R5623:Sgk3 UTSW 1 9802295 intron probably benign
R5936:Sgk3 UTSW 1 9885820 intron probably benign
R6842:Sgk3 UTSW 1 9898754 missense probably benign
R7055:Sgk3 UTSW 1 9886059 missense probably damaging 1.00
R7186:Sgk3 UTSW 1 9886002 missense probably benign 0.00
R7336:Sgk3 UTSW 1 9884476 missense possibly damaging 0.88
R7429:Sgk3 UTSW 1 9872258 missense probably benign 0.00
R7430:Sgk3 UTSW 1 9872258 missense probably benign 0.00
R7787:Sgk3 UTSW 1 9881791 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTGTGACAGCCTCAAGAC -3'
(R):5'- GGAACACCGAAATTACATATTGGTG -3'

Sequencing Primer
(F):5'- CTTCTTTAGTGTGAGTAACAGTACC -3'
(R):5'- TGGTGTTTGAAAGTAATGAAGCC -3'
Posted On2018-08-29