Incidental Mutation 'R6778:Wdr47'
ID531362
Institutional Source Beutler Lab
Gene Symbol Wdr47
Ensembl Gene ENSMUSG00000040389
Gene NameWD repeat domain 47
Synonyms1810073M12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6778 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location108591279-108645719 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108633096 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 602 (N602K)
Ref Sequence ENSEMBL: ENSMUSP00000057482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051145]
Predicted Effect probably benign
Transcript: ENSMUST00000051145
AA Change: N602K

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000057482
Gene: ENSMUSG00000040389
AA Change: N602K

DomainStartEndE-ValueType
LisH 10 42 8.87e-4 SMART
CTLH 45 102 1.93e-13 SMART
low complexity region 137 146 N/A INTRINSIC
low complexity region 226 254 N/A INTRINSIC
coiled coil region 414 455 N/A INTRINSIC
low complexity region 506 523 N/A INTRINSIC
WD40 597 635 7e-4 SMART
WD40 648 690 5.18e-7 SMART
WD40 698 742 2.28e2 SMART
WD40 745 783 9.38e-5 SMART
WD40 790 829 1.31e-3 SMART
WD40 832 871 1.28e-6 SMART
WD40 878 917 7.39e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts14 T A 10: 61,225,452 N403Y probably damaging Het
Akap6 A G 12: 53,025,816 E989G probably damaging Het
Aoc2 A G 11: 101,325,361 N90S probably damaging Het
Apol9a T C 15: 77,404,333 Y278C probably benign Het
Casq2 T A 3: 102,127,931 probably null Het
Ccdc7a T A 8: 128,821,120 T1284S possibly damaging Het
Dlat A G 9: 50,650,857 L289P probably damaging Het
Dnah8 C T 17: 30,635,666 P101S probably benign Het
Dzip3 C A 16: 48,982,083 A28S probably benign Het
Fam205c T C 4: 42,868,522 K367R possibly damaging Het
Ffar4 A G 19: 38,113,664 E249G possibly damaging Het
Fubp3 A T 2: 31,598,673 K180N possibly damaging Het
Gm7489 T A 15: 53,885,952 probably benign Het
Ifitm6 A T 7: 141,016,143 M59K possibly damaging Het
Igkv4-80 A T 6: 69,016,561 Y115* probably null Het
Igsf21 G T 4: 140,034,648 R240S probably benign Het
Kank4 A T 4: 98,761,505 N942K probably benign Het
Man2a1 C A 17: 64,714,635 T35K possibly damaging Het
Mvk T A 5: 114,452,380 D193E probably benign Het
Npas2 T A 1: 39,325,300 M241K possibly damaging Het
Npsr1 T A 9: 24,254,618 I100N possibly damaging Het
Olfml2b A G 1: 170,645,070 D50G probably damaging Het
Olfr961 T A 9: 39,646,747 V7E probably damaging Het
Pcnx A G 12: 81,918,871 D604G probably damaging Het
Pitx2 C T 3: 129,218,743 P254L probably damaging Het
Rdh10 T C 1: 16,106,184 F56S probably damaging Het
Rin1 T C 19: 5,054,886 L647P probably damaging Het
Sgk3 T A 1: 9,886,144 probably null Het
Sgpp1 A G 12: 75,716,294 I371T probably benign Het
Slc12a9 T C 5: 137,315,081 Y872C possibly damaging Het
Syne1 A G 10: 5,102,406 F7487L probably damaging Het
Tars T C 15: 11,389,699 N375S probably benign Het
Tbc1d31 A G 15: 57,938,029 Y320C probably damaging Het
Tbl1xr1 T A 3: 22,189,782 F73L probably benign Het
Tmem145 G A 7: 25,311,376 V378I probably benign Het
Tmprss11d T C 5: 86,309,350 H150R probably benign Het
Tnc T G 4: 63,995,598 I1326L probably benign Het
Trpc7 T C 13: 56,804,687 Y502C probably damaging Het
Usp32 T C 11: 85,025,686 I811V probably benign Het
Vmn1r71 C T 7: 10,748,216 A182T probably benign Het
Other mutations in Wdr47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Wdr47 APN 3 108618734 missense probably benign 0.04
IGL01730:Wdr47 APN 3 108611396 missense probably damaging 1.00
IGL01821:Wdr47 APN 3 108627204 missense probably damaging 1.00
IGL03367:Wdr47 APN 3 108629773 splice site probably benign
R0025:Wdr47 UTSW 3 108637991 missense probably damaging 1.00
R0217:Wdr47 UTSW 3 108637020 missense probably damaging 0.96
R0733:Wdr47 UTSW 3 108618623 missense probably damaging 1.00
R1329:Wdr47 UTSW 3 108627299 missense probably benign 0.14
R1330:Wdr47 UTSW 3 108629753 missense probably benign 0.30
R1894:Wdr47 UTSW 3 108623376 missense possibly damaging 0.56
R2004:Wdr47 UTSW 3 108627442 nonsense probably null
R2040:Wdr47 UTSW 3 108623372 missense probably benign 0.01
R2242:Wdr47 UTSW 3 108619115 missense probably damaging 1.00
R3795:Wdr47 UTSW 3 108624737 critical splice donor site probably null
R5026:Wdr47 UTSW 3 108618522 nonsense probably null
R5732:Wdr47 UTSW 3 108633156 nonsense probably null
R5823:Wdr47 UTSW 3 108643085 missense probably damaging 1.00
R5838:Wdr47 UTSW 3 108624736 critical splice donor site probably null
R5890:Wdr47 UTSW 3 108610012 missense probably damaging 1.00
R5896:Wdr47 UTSW 3 108619006 missense probably damaging 1.00
R5898:Wdr47 UTSW 3 108637885 splice site probably null
R7019:Wdr47 UTSW 3 108614355 nonsense probably null
R7051:Wdr47 UTSW 3 108618524 missense probably damaging 1.00
R7535:Wdr47 UTSW 3 108629711 missense probably benign 0.01
R7642:Wdr47 UTSW 3 108643164 missense possibly damaging 0.47
R7709:Wdr47 UTSW 3 108618521 missense probably damaging 1.00
R8048:Wdr47 UTSW 3 108618968 missense probably damaging 0.99
X0062:Wdr47 UTSW 3 108619058 missense probably benign 0.01
Z1177:Wdr47 UTSW 3 108619114 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCAGTTAAATGATGCACAGC -3'
(R):5'- GCAGTCAACAGAGCCAACTG -3'

Sequencing Primer
(F):5'- TGAACTTAGGTCCTCTACAAGAGC -3'
(R):5'- GAGCCAACTGCAGAACAAGGC -3'
Posted On2018-08-29