Incidental Mutation 'R6778:Tmprss11d'
ID531368
Institutional Source Beutler Lab
Gene Symbol Tmprss11d
Ensembl Gene ENSMUSG00000061259
Gene Nametransmembrane protease, serine 11d
SynonymsAsP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R6778 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location86302217-86373420 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86309350 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 150 (H150R)
Ref Sequence ENSEMBL: ENSMUSP00000113079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031175] [ENSMUST00000122377]
Predicted Effect probably benign
Transcript: ENSMUST00000031175
AA Change: H288R

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000031175
Gene: ENSMUSG00000061259
AA Change: H288R

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
SEA 41 164 4.92e-2 SMART
Tryp_SPc 185 411 1.29e-86 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122377
AA Change: H150R

PolyPhen 2 Score 0.344 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113079
Gene: ENSMUSG00000061259
AA Change: H150R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Tryp_SPc 47 273 1.29e-86 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a trypsin-like serine protease released from the submucosal serous glands onto mucous membrane. It is a type II integral membrane protein and has 29-38% identity in the sequence of the catalytic region with human hepsin, enteropeptidase, acrosin, and mast cell tryptase. The noncatalytic region has little similarity to other known proteins. This protein may play some biological role in the host defense system on the mucous membrane independently of or in cooperation with other substances in airway mucous or bronchial secretions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Aged female mice homozygous for a knock-in allele exhibit increased lymphoma incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts14 T A 10: 61,225,452 N403Y probably damaging Het
Akap6 A G 12: 53,025,816 E989G probably damaging Het
Aoc2 A G 11: 101,325,361 N90S probably damaging Het
Apol9a T C 15: 77,404,333 Y278C probably benign Het
Casq2 T A 3: 102,127,931 probably null Het
Ccdc7a T A 8: 128,821,120 T1284S possibly damaging Het
Dlat A G 9: 50,650,857 L289P probably damaging Het
Dnah8 C T 17: 30,635,666 P101S probably benign Het
Dzip3 C A 16: 48,982,083 A28S probably benign Het
Fam205c T C 4: 42,868,522 K367R possibly damaging Het
Ffar4 A G 19: 38,113,664 E249G possibly damaging Het
Fubp3 A T 2: 31,598,673 K180N possibly damaging Het
Gm7489 T A 15: 53,885,952 probably benign Het
Ifitm6 A T 7: 141,016,143 M59K possibly damaging Het
Igkv4-80 A T 6: 69,016,561 Y115* probably null Het
Igsf21 G T 4: 140,034,648 R240S probably benign Het
Kank4 A T 4: 98,761,505 N942K probably benign Het
Man2a1 C A 17: 64,714,635 T35K possibly damaging Het
Mvk T A 5: 114,452,380 D193E probably benign Het
Npas2 T A 1: 39,325,300 M241K possibly damaging Het
Npsr1 T A 9: 24,254,618 I100N possibly damaging Het
Olfml2b A G 1: 170,645,070 D50G probably damaging Het
Olfr961 T A 9: 39,646,747 V7E probably damaging Het
Pcnx A G 12: 81,918,871 D604G probably damaging Het
Pitx2 C T 3: 129,218,743 P254L probably damaging Het
Rdh10 T C 1: 16,106,184 F56S probably damaging Het
Rin1 T C 19: 5,054,886 L647P probably damaging Het
Sgk3 T A 1: 9,886,144 probably null Het
Sgpp1 A G 12: 75,716,294 I371T probably benign Het
Slc12a9 T C 5: 137,315,081 Y872C possibly damaging Het
Syne1 A G 10: 5,102,406 F7487L probably damaging Het
Tars T C 15: 11,389,699 N375S probably benign Het
Tbc1d31 A G 15: 57,938,029 Y320C probably damaging Het
Tbl1xr1 T A 3: 22,189,782 F73L probably benign Het
Tmem145 G A 7: 25,311,376 V378I probably benign Het
Tnc T G 4: 63,995,598 I1326L probably benign Het
Trpc7 T C 13: 56,804,687 Y502C probably damaging Het
Usp32 T C 11: 85,025,686 I811V probably benign Het
Vmn1r71 C T 7: 10,748,216 A182T probably benign Het
Wdr47 T A 3: 108,633,096 N602K probably benign Het
Other mutations in Tmprss11d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02393:Tmprss11d APN 5 86303612 makesense probably null
IGL02519:Tmprss11d APN 5 86306305 missense probably damaging 1.00
IGL02666:Tmprss11d APN 5 86331193 missense probably damaging 1.00
IGL02974:Tmprss11d APN 5 86306376 missense probably damaging 1.00
IGL03305:Tmprss11d APN 5 86326420 missense probably damaging 1.00
R0440:Tmprss11d UTSW 5 86338812 missense probably damaging 0.96
R1261:Tmprss11d UTSW 5 86309380 missense possibly damaging 0.52
R1544:Tmprss11d UTSW 5 86338799 missense probably damaging 1.00
R2018:Tmprss11d UTSW 5 86339554 missense probably damaging 0.97
R2036:Tmprss11d UTSW 5 86309269 missense probably damaging 0.97
R2267:Tmprss11d UTSW 5 86373349 missense probably benign 0.01
R4063:Tmprss11d UTSW 5 86309318 missense probably benign 0.04
R4087:Tmprss11d UTSW 5 86309279 missense probably damaging 1.00
R4665:Tmprss11d UTSW 5 86309401 missense probably damaging 1.00
R4666:Tmprss11d UTSW 5 86309401 missense probably damaging 1.00
R4784:Tmprss11d UTSW 5 86306281 missense probably damaging 0.99
R4785:Tmprss11d UTSW 5 86306281 missense probably damaging 0.99
R5077:Tmprss11d UTSW 5 86309263 critical splice donor site probably null
R5201:Tmprss11d UTSW 5 86309355 missense possibly damaging 0.92
R5350:Tmprss11d UTSW 5 86338887 missense probably benign 0.08
R5523:Tmprss11d UTSW 5 86338870 missense probably benign 0.05
R5618:Tmprss11d UTSW 5 86306295 missense probably benign
R5643:Tmprss11d UTSW 5 86326529 missense probably benign 0.00
R5834:Tmprss11d UTSW 5 86306310 missense probably damaging 1.00
R6422:Tmprss11d UTSW 5 86309425 missense probably damaging 1.00
R6706:Tmprss11d UTSW 5 86331103 missense probably benign 0.03
R6735:Tmprss11d UTSW 5 86309300 missense probably damaging 1.00
R7013:Tmprss11d UTSW 5 86326573 missense probably damaging 0.99
R7273:Tmprss11d UTSW 5 86337239 missense probably damaging 1.00
R7488:Tmprss11d UTSW 5 86326450 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCCTCATCTGAGAACTGACAAG -3'
(R):5'- TCCTAATCCTCAATATTGGACAGC -3'

Sequencing Primer
(F):5'- CTGGTCTACACAGTGGATTCCAAG -3'
(R):5'- CAATATTGGACAGCCACCTTTGGG -3'
Posted On2018-08-29