Incidental Mutation 'R6778:Mvk'
ID531369
Institutional Source Beutler Lab
Gene Symbol Mvk
Ensembl Gene ENSMUSG00000041939
Gene Namemevalonate kinase
Synonyms2310010A05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6778 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location114444269-114460591 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 114452380 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 193 (D193E)
Ref Sequence ENSEMBL: ENSMUSP00000143347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043760] [ENSMUST00000112239] [ENSMUST00000124260] [ENSMUST00000125650] [ENSMUST00000137167] [ENSMUST00000139420]
Predicted Effect probably benign
Transcript: ENSMUST00000043760
AA Change: D181E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000036971
Gene: ENSMUSG00000041939
AA Change: D181E

DomainStartEndE-ValueType
low complexity region 108 118 N/A INTRINSIC
Pfam:GHMP_kinases_N 130 212 7.6e-26 PFAM
Pfam:GHMP_kinases_C 291 365 2.1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112239
AA Change: D193E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107858
Gene: ENSMUSG00000041939
AA Change: D193E

DomainStartEndE-ValueType
low complexity region 120 130 N/A INTRINSIC
Pfam:GHMP_kinases_N 142 224 1.6e-25 PFAM
Pfam:GHMP_kinases_C 303 377 8.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124260
AA Change: D193E

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000143347
Gene: ENSMUSG00000041939
AA Change: D193E

DomainStartEndE-ValueType
low complexity region 120 130 N/A INTRINSIC
Pfam:GHMP_kinases_N 142 224 5.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125650
AA Change: D193E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000114611
Gene: ENSMUSG00000041939
AA Change: D193E

DomainStartEndE-ValueType
low complexity region 120 130 N/A INTRINSIC
Pfam:GHMP_kinases_N 142 224 1.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137167
AA Change: D181E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000142758
Gene: ENSMUSG00000041939
AA Change: D181E

DomainStartEndE-ValueType
low complexity region 108 118 N/A INTRINSIC
Pfam:GHMP_kinases_N 130 212 5.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139420
SMART Domains Protein: ENSMUSP00000142376
Gene: ENSMUSG00000041939

DomainStartEndE-ValueType
PDB:2R42|A 1 62 6e-30 PDB
SCOP:d1kvka1 2 31 1e-10 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes mevalonate kinase, a key enzyme involved in the biosynthesis of cholesterol and non-sterol isoprenes. The complete lack of encoded protein is lethal to mouse embryos. Mice lacking one allele of this gene exhibit increased levels of mevalonate in spleen, heart and kidney, as well as increased levels of serum immunoglobulins A and D. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts14 T A 10: 61,225,452 N403Y probably damaging Het
Akap6 A G 12: 53,025,816 E989G probably damaging Het
Aoc2 A G 11: 101,325,361 N90S probably damaging Het
Apol9a T C 15: 77,404,333 Y278C probably benign Het
Casq2 T A 3: 102,127,931 probably null Het
Ccdc7a T A 8: 128,821,120 T1284S possibly damaging Het
Dlat A G 9: 50,650,857 L289P probably damaging Het
Dnah8 C T 17: 30,635,666 P101S probably benign Het
Dzip3 C A 16: 48,982,083 A28S probably benign Het
Fam205c T C 4: 42,868,522 K367R possibly damaging Het
Ffar4 A G 19: 38,113,664 E249G possibly damaging Het
Fubp3 A T 2: 31,598,673 K180N possibly damaging Het
Gm7489 T A 15: 53,885,952 probably benign Het
Ifitm6 A T 7: 141,016,143 M59K possibly damaging Het
Igkv4-80 A T 6: 69,016,561 Y115* probably null Het
Igsf21 G T 4: 140,034,648 R240S probably benign Het
Kank4 A T 4: 98,761,505 N942K probably benign Het
Man2a1 C A 17: 64,714,635 T35K possibly damaging Het
Npas2 T A 1: 39,325,300 M241K possibly damaging Het
Npsr1 T A 9: 24,254,618 I100N possibly damaging Het
Olfml2b A G 1: 170,645,070 D50G probably damaging Het
Olfr961 T A 9: 39,646,747 V7E probably damaging Het
Pcnx A G 12: 81,918,871 D604G probably damaging Het
Pitx2 C T 3: 129,218,743 P254L probably damaging Het
Rdh10 T C 1: 16,106,184 F56S probably damaging Het
Rin1 T C 19: 5,054,886 L647P probably damaging Het
Sgk3 T A 1: 9,886,144 probably null Het
Sgpp1 A G 12: 75,716,294 I371T probably benign Het
Slc12a9 T C 5: 137,315,081 Y872C possibly damaging Het
Syne1 A G 10: 5,102,406 F7487L probably damaging Het
Tars T C 15: 11,389,699 N375S probably benign Het
Tbc1d31 A G 15: 57,938,029 Y320C probably damaging Het
Tbl1xr1 T A 3: 22,189,782 F73L probably benign Het
Tmem145 G A 7: 25,311,376 V378I probably benign Het
Tmprss11d T C 5: 86,309,350 H150R probably benign Het
Tnc T G 4: 63,995,598 I1326L probably benign Het
Trpc7 T C 13: 56,804,687 Y502C probably damaging Het
Usp32 T C 11: 85,025,686 I811V probably benign Het
Vmn1r71 C T 7: 10,748,216 A182T probably benign Het
Wdr47 T A 3: 108,633,096 N602K probably benign Het
Other mutations in Mvk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Mvk APN 5 114445441 missense probably benign 0.00
IGL01615:Mvk APN 5 114446292 missense probably benign 0.41
IGL02735:Mvk APN 5 114450819 missense probably benign 0.00
R0206:Mvk UTSW 5 114458974 missense probably damaging 1.00
R1474:Mvk UTSW 5 114460096 missense probably damaging 0.99
R2511:Mvk UTSW 5 114450398 nonsense probably null
R4377:Mvk UTSW 5 114452961 intron probably benign
R4861:Mvk UTSW 5 114460197 intron probably benign
R4902:Mvk UTSW 5 114455999 missense probably benign 0.05
R5073:Mvk UTSW 5 114452952 intron probably benign
R5355:Mvk UTSW 5 114452438 missense probably damaging 1.00
R5411:Mvk UTSW 5 114458973 missense probably benign 0.00
R5637:Mvk UTSW 5 114455942 missense possibly damaging 0.47
R5687:Mvk UTSW 5 114450765 missense probably damaging 1.00
R7402:Mvk UTSW 5 114455978 missense possibly damaging 0.79
R8305:Mvk UTSW 5 114450779 missense probably damaging 1.00
Z1088:Mvk UTSW 5 114458934 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAAACAAAGGTCATTGTCACC -3'
(R):5'- GAACAGGAACGTGTTCTTCTCC -3'

Sequencing Primer
(F):5'- TCATTGTCACCTTAGGCCGAGAG -3'
(R):5'- TCCTTAGAAGCCCCTAACTGG -3'
Posted On2018-08-29