Incidental Mutation 'R6778:Slc12a9'
ID531370
Institutional Source Beutler Lab
Gene Symbol Slc12a9
Ensembl Gene ENSMUSG00000037344
Gene Namesolute carrier family 12 (potassium/chloride transporters), member 9
SynonymsCIP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.369) question?
Stock #R6778 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location137314558-137333597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 137315081 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 872 (Y872C)
Ref Sequence ENSEMBL: ENSMUSP00000038106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024119] [ENSMUST00000039991] [ENSMUST00000199121]
Predicted Effect probably benign
Transcript: ENSMUST00000024119
SMART Domains Protein: ENSMUSP00000024119
Gene: ENSMUSG00000023348

DomainStartEndE-ValueType
low complexity region 155 171 N/A INTRINSIC
low complexity region 222 234 N/A INTRINSIC
low complexity region 239 262 N/A INTRINSIC
LIM 282 335 4.59e-14 SMART
LIM 342 394 1.41e-14 SMART
LIM 402 464 5.65e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000039991
AA Change: Y872C

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038106
Gene: ENSMUSG00000037344
AA Change: Y872C

DomainStartEndE-ValueType
Pfam:AA_permease 42 536 1.8e-114 PFAM
Pfam:SLC12 545 639 4.6e-13 PFAM
low complexity region 804 817 N/A INTRINSIC
low complexity region 845 866 N/A INTRINSIC
low complexity region 871 888 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199121
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts14 T A 10: 61,225,452 N403Y probably damaging Het
Akap6 A G 12: 53,025,816 E989G probably damaging Het
Aoc2 A G 11: 101,325,361 N90S probably damaging Het
Apol9a T C 15: 77,404,333 Y278C probably benign Het
Casq2 T A 3: 102,127,931 probably null Het
Ccdc7a T A 8: 128,821,120 T1284S possibly damaging Het
Dlat A G 9: 50,650,857 L289P probably damaging Het
Dnah8 C T 17: 30,635,666 P101S probably benign Het
Dzip3 C A 16: 48,982,083 A28S probably benign Het
Fam205c T C 4: 42,868,522 K367R possibly damaging Het
Ffar4 A G 19: 38,113,664 E249G possibly damaging Het
Fubp3 A T 2: 31,598,673 K180N possibly damaging Het
Gm7489 T A 15: 53,885,952 probably benign Het
Ifitm6 A T 7: 141,016,143 M59K possibly damaging Het
Igkv4-80 A T 6: 69,016,561 Y115* probably null Het
Igsf21 G T 4: 140,034,648 R240S probably benign Het
Kank4 A T 4: 98,761,505 N942K probably benign Het
Man2a1 C A 17: 64,714,635 T35K possibly damaging Het
Mvk T A 5: 114,452,380 D193E probably benign Het
Npas2 T A 1: 39,325,300 M241K possibly damaging Het
Npsr1 T A 9: 24,254,618 I100N possibly damaging Het
Olfml2b A G 1: 170,645,070 D50G probably damaging Het
Olfr961 T A 9: 39,646,747 V7E probably damaging Het
Pcnx A G 12: 81,918,871 D604G probably damaging Het
Pitx2 C T 3: 129,218,743 P254L probably damaging Het
Rdh10 T C 1: 16,106,184 F56S probably damaging Het
Rin1 T C 19: 5,054,886 L647P probably damaging Het
Sgk3 T A 1: 9,886,144 probably null Het
Sgpp1 A G 12: 75,716,294 I371T probably benign Het
Syne1 A G 10: 5,102,406 F7487L probably damaging Het
Tars T C 15: 11,389,699 N375S probably benign Het
Tbc1d31 A G 15: 57,938,029 Y320C probably damaging Het
Tbl1xr1 T A 3: 22,189,782 F73L probably benign Het
Tmem145 G A 7: 25,311,376 V378I probably benign Het
Tmprss11d T C 5: 86,309,350 H150R probably benign Het
Tnc T G 4: 63,995,598 I1326L probably benign Het
Trpc7 T C 13: 56,804,687 Y502C probably damaging Het
Usp32 T C 11: 85,025,686 I811V probably benign Het
Vmn1r71 C T 7: 10,748,216 A182T probably benign Het
Wdr47 T A 3: 108,633,096 N602K probably benign Het
Other mutations in Slc12a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01139:Slc12a9 APN 5 137322842 missense probably damaging 0.97
IGL01288:Slc12a9 APN 5 137330938 splice site probably null
IGL01829:Slc12a9 APN 5 137327365 splice site probably benign
IGL02379:Slc12a9 APN 5 137321429 missense probably damaging 0.99
IGL02975:Slc12a9 APN 5 137322443 missense probably damaging 1.00
R0145:Slc12a9 UTSW 5 137315288 missense probably damaging 1.00
R0325:Slc12a9 UTSW 5 137322846 missense probably damaging 1.00
R0645:Slc12a9 UTSW 5 137315376 missense probably benign 0.01
R1004:Slc12a9 UTSW 5 137322524 missense probably damaging 1.00
R1646:Slc12a9 UTSW 5 137323149 missense probably damaging 1.00
R2280:Slc12a9 UTSW 5 137332212 missense probably damaging 0.99
R2425:Slc12a9 UTSW 5 137315597 missense probably damaging 1.00
R2909:Slc12a9 UTSW 5 137332201 missense probably benign
R3617:Slc12a9 UTSW 5 137332497 missense probably damaging 1.00
R4255:Slc12a9 UTSW 5 137321432 missense probably damaging 0.99
R4431:Slc12a9 UTSW 5 137321513 missense probably benign 0.05
R5384:Slc12a9 UTSW 5 137331014 missense probably damaging 1.00
R5665:Slc12a9 UTSW 5 137321403 missense possibly damaging 0.79
R6682:Slc12a9 UTSW 5 137327401 missense probably damaging 1.00
R6977:Slc12a9 UTSW 5 137315813 missense probably damaging 1.00
R7366:Slc12a9 UTSW 5 137328623 nonsense probably null
R7489:Slc12a9 UTSW 5 137322820 missense probably damaging 0.96
R7491:Slc12a9 UTSW 5 137322820 missense probably damaging 0.96
R7844:Slc12a9 UTSW 5 137332186 missense probably damaging 1.00
R7955:Slc12a9 UTSW 5 137325546 missense probably damaging 1.00
R8350:Slc12a9 UTSW 5 137315475 missense probably benign 0.06
R8351:Slc12a9 UTSW 5 137315475 missense probably benign 0.06
R8351:Slc12a9 UTSW 5 137328448 missense probably benign
R8352:Slc12a9 UTSW 5 137315475 missense probably benign 0.06
R8393:Slc12a9 UTSW 5 137321436 missense probably damaging 1.00
R8450:Slc12a9 UTSW 5 137315475 missense probably benign 0.06
R8451:Slc12a9 UTSW 5 137315475 missense probably benign 0.06
R8451:Slc12a9 UTSW 5 137328448 missense probably benign
R8452:Slc12a9 UTSW 5 137315475 missense probably benign 0.06
RF017:Slc12a9 UTSW 5 137325550 missense probably damaging 1.00
Z1177:Slc12a9 UTSW 5 137322437 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGTCCATTGCTCAGAATG -3'
(R):5'- ATCTTAAGCATGGTGCCTGCC -3'

Sequencing Primer
(F):5'- TCAGAATGAGCCTGGGCC -3'
(R):5'- TTCGGGCCCTGTTGAGTCAAC -3'
Posted On2018-08-29