Incidental Mutation 'R6778:Tmem145'
ID531373
Institutional Source Beutler Lab
Gene Symbol Tmem145
Ensembl Gene ENSMUSG00000043843
Gene Nametransmembrane protein 145
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R6778 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location25306106-25316195 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25311376 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 378 (V378I)
Ref Sequence ENSEMBL: ENSMUSP00000104046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108409] [ENSMUST00000119703]
Predicted Effect probably benign
Transcript: ENSMUST00000108409
AA Change: V378I

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000104046
Gene: ENSMUSG00000043843
AA Change: V378I

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:GpcrRhopsn4 157 411 7.5e-81 PFAM
low complexity region 486 503 N/A INTRINSIC
low complexity region 505 516 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119703
AA Change: V364I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000112676
Gene: ENSMUSG00000043843
AA Change: V364I

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:GpcrRhopsn4 143 397 4.3e-81 PFAM
low complexity region 478 493 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit progressive hearing impairment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts14 T A 10: 61,225,452 N403Y probably damaging Het
Akap6 A G 12: 53,025,816 E989G probably damaging Het
Aoc2 A G 11: 101,325,361 N90S probably damaging Het
Apol9a T C 15: 77,404,333 Y278C probably benign Het
Casq2 T A 3: 102,127,931 probably null Het
Ccdc7a T A 8: 128,821,120 T1284S possibly damaging Het
Dlat A G 9: 50,650,857 L289P probably damaging Het
Dnah8 C T 17: 30,635,666 P101S probably benign Het
Dzip3 C A 16: 48,982,083 A28S probably benign Het
Fam205c T C 4: 42,868,522 K367R possibly damaging Het
Ffar4 A G 19: 38,113,664 E249G possibly damaging Het
Fubp3 A T 2: 31,598,673 K180N possibly damaging Het
Gm7489 T A 15: 53,885,952 probably benign Het
Ifitm6 A T 7: 141,016,143 M59K possibly damaging Het
Igkv4-80 A T 6: 69,016,561 Y115* probably null Het
Igsf21 G T 4: 140,034,648 R240S probably benign Het
Kank4 A T 4: 98,761,505 N942K probably benign Het
Man2a1 C A 17: 64,714,635 T35K possibly damaging Het
Mvk T A 5: 114,452,380 D193E probably benign Het
Npas2 T A 1: 39,325,300 M241K possibly damaging Het
Npsr1 T A 9: 24,254,618 I100N possibly damaging Het
Olfml2b A G 1: 170,645,070 D50G probably damaging Het
Olfr961 T A 9: 39,646,747 V7E probably damaging Het
Pcnx A G 12: 81,918,871 D604G probably damaging Het
Pitx2 C T 3: 129,218,743 P254L probably damaging Het
Rdh10 T C 1: 16,106,184 F56S probably damaging Het
Rin1 T C 19: 5,054,886 L647P probably damaging Het
Sgk3 T A 1: 9,886,144 probably null Het
Sgpp1 A G 12: 75,716,294 I371T probably benign Het
Slc12a9 T C 5: 137,315,081 Y872C possibly damaging Het
Syne1 A G 10: 5,102,406 F7487L probably damaging Het
Tars T C 15: 11,389,699 N375S probably benign Het
Tbc1d31 A G 15: 57,938,029 Y320C probably damaging Het
Tbl1xr1 T A 3: 22,189,782 F73L probably benign Het
Tmprss11d T C 5: 86,309,350 H150R probably benign Het
Tnc T G 4: 63,995,598 I1326L probably benign Het
Trpc7 T C 13: 56,804,687 Y502C probably damaging Het
Usp32 T C 11: 85,025,686 I811V probably benign Het
Vmn1r71 C T 7: 10,748,216 A182T probably benign Het
Wdr47 T A 3: 108,633,096 N602K probably benign Het
Other mutations in Tmem145
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Tmem145 APN 7 25314730 missense possibly damaging 0.88
IGL00958:Tmem145 APN 7 25307357 critical splice donor site probably null
IGL01347:Tmem145 APN 7 25314835 missense probably damaging 0.97
IGL01936:Tmem145 APN 7 25311391 missense probably damaging 0.97
IGL02526:Tmem145 APN 7 25308232 missense probably benign 0.20
IGL02686:Tmem145 APN 7 25314725 missense probably damaging 1.00
IGL03182:Tmem145 APN 7 25314879 missense probably damaging 1.00
R0087:Tmem145 UTSW 7 25307843 missense probably damaging 1.00
R0180:Tmem145 UTSW 7 25314699 missense probably benign 0.05
R0329:Tmem145 UTSW 7 25308674 splice site probably benign
R0504:Tmem145 UTSW 7 25311362 missense probably damaging 1.00
R1488:Tmem145 UTSW 7 25307435 splice site probably null
R1681:Tmem145 UTSW 7 25314734 missense possibly damaging 0.95
R2352:Tmem145 UTSW 7 25306173 missense probably benign
R3834:Tmem145 UTSW 7 25311361 missense probably damaging 1.00
R4175:Tmem145 UTSW 7 25308793 missense probably benign 0.04
R4414:Tmem145 UTSW 7 25307129 missense probably damaging 1.00
R4485:Tmem145 UTSW 7 25307162 missense possibly damaging 0.76
R4631:Tmem145 UTSW 7 25307825 missense probably benign 0.00
R4983:Tmem145 UTSW 7 25308602 missense probably benign 0.03
R4999:Tmem145 UTSW 7 25309034 missense probably benign 0.04
R5772:Tmem145 UTSW 7 25315614 missense probably benign 0.21
R5821:Tmem145 UTSW 7 25315521 missense probably benign 0.30
R5909:Tmem145 UTSW 7 25308193 missense possibly damaging 0.89
R6021:Tmem145 UTSW 7 25308845 splice site probably null
R6430:Tmem145 UTSW 7 25309038 missense possibly damaging 0.84
R6768:Tmem145 UTSW 7 25308636 missense probably damaging 1.00
R7428:Tmem145 UTSW 7 25307165 critical splice donor site probably null
R7536:Tmem145 UTSW 7 25307869 missense probably damaging 1.00
R7748:Tmem145 UTSW 7 25307328 nonsense probably null
R7826:Tmem145 UTSW 7 25307514 missense probably damaging 1.00
R8253:Tmem145 UTSW 7 25307514 missense probably damaging 1.00
R8441:Tmem145 UTSW 7 25308775 missense possibly damaging 0.62
Z1177:Tmem145 UTSW 7 25309646 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGCAGAGTTAAATTCAGCC -3'
(R):5'- AGAGGGCAACACATTCAAGC -3'

Sequencing Primer
(F):5'- GAGCAGAGTTAAATTCAGCCCAGTC -3'
(R):5'- GAGGGCAACACATTCAAGCACATAG -3'
Posted On2018-08-29