Incidental Mutation 'R6778:Ccdc7a'
ID531375
Institutional Source Beutler Lab
Gene Symbol Ccdc7a
Ensembl Gene ENSMUSG00000025808
Gene Namecoiled-coil domain containing 7A
SynonymsCcdc7, 4930517G15Rik, 4930540C21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R6778 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location128734235-129065517 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 128821120 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 1284 (T1284S)
Ref Sequence ENSEMBL: ENSMUSP00000149790 (fasta)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214889
AA Change: T1284S

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts14 T A 10: 61,225,452 N403Y probably damaging Het
Akap6 A G 12: 53,025,816 E989G probably damaging Het
Aoc2 A G 11: 101,325,361 N90S probably damaging Het
Apol9a T C 15: 77,404,333 Y278C probably benign Het
Casq2 T A 3: 102,127,931 probably null Het
Dlat A G 9: 50,650,857 L289P probably damaging Het
Dnah8 C T 17: 30,635,666 P101S probably benign Het
Dzip3 C A 16: 48,982,083 A28S probably benign Het
Fam205c T C 4: 42,868,522 K367R possibly damaging Het
Ffar4 A G 19: 38,113,664 E249G possibly damaging Het
Fubp3 A T 2: 31,598,673 K180N possibly damaging Het
Gm7489 T A 15: 53,885,952 probably benign Het
Ifitm6 A T 7: 141,016,143 M59K possibly damaging Het
Igkv4-80 A T 6: 69,016,561 Y115* probably null Het
Igsf21 G T 4: 140,034,648 R240S probably benign Het
Kank4 A T 4: 98,761,505 N942K probably benign Het
Man2a1 C A 17: 64,714,635 T35K possibly damaging Het
Mvk T A 5: 114,452,380 D193E probably benign Het
Npas2 T A 1: 39,325,300 M241K possibly damaging Het
Npsr1 T A 9: 24,254,618 I100N possibly damaging Het
Olfml2b A G 1: 170,645,070 D50G probably damaging Het
Olfr961 T A 9: 39,646,747 V7E probably damaging Het
Pcnx A G 12: 81,918,871 D604G probably damaging Het
Pitx2 C T 3: 129,218,743 P254L probably damaging Het
Rdh10 T C 1: 16,106,184 F56S probably damaging Het
Rin1 T C 19: 5,054,886 L647P probably damaging Het
Sgk3 T A 1: 9,886,144 probably null Het
Sgpp1 A G 12: 75,716,294 I371T probably benign Het
Slc12a9 T C 5: 137,315,081 Y872C possibly damaging Het
Syne1 A G 10: 5,102,406 F7487L probably damaging Het
Tars T C 15: 11,389,699 N375S probably benign Het
Tbc1d31 A G 15: 57,938,029 Y320C probably damaging Het
Tbl1xr1 T A 3: 22,189,782 F73L probably benign Het
Tmem145 G A 7: 25,311,376 V378I probably benign Het
Tmprss11d T C 5: 86,309,350 H150R probably benign Het
Tnc T G 4: 63,995,598 I1326L probably benign Het
Trpc7 T C 13: 56,804,687 Y502C probably damaging Het
Usp32 T C 11: 85,025,686 I811V probably benign Het
Vmn1r71 C T 7: 10,748,216 A182T probably benign Het
Wdr47 T A 3: 108,633,096 N602K probably benign Het
Other mutations in Ccdc7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Ccdc7a APN 8 129026754 splice site probably benign
IGL01019:Ccdc7a APN 8 129061618 missense probably benign 0.05
IGL01553:Ccdc7a APN 8 129026591 splice site probably benign
IGL01577:Ccdc7a APN 8 128988763 missense probably damaging 0.96
IGL03114:Ccdc7a APN 8 129026689 missense possibly damaging 0.62
IGL03323:Ccdc7a APN 8 129058763 missense probably benign 0.02
R1517:Ccdc7a UTSW 8 129061681 missense probably damaging 0.99
R1804:Ccdc7a UTSW 8 128988766 nonsense probably null
R1957:Ccdc7a UTSW 8 128980135 missense probably damaging 0.99
R4926:Ccdc7a UTSW 8 128980054 intron probably benign
R4981:Ccdc7a UTSW 8 128984983 missense probably benign 0.35
R5193:Ccdc7a UTSW 8 128988797 missense probably benign 0.02
R5273:Ccdc7a UTSW 8 129061609 frame shift probably null
R5486:Ccdc7a UTSW 8 128985403 missense probably damaging 0.98
R5505:Ccdc7a UTSW 8 128980174 missense possibly damaging 0.73
R5562:Ccdc7a UTSW 8 129058785 missense possibly damaging 0.79
R5704:Ccdc7a UTSW 8 128980096 splice site probably benign
R6256:Ccdc7a UTSW 8 128935593 intron probably null
R6273:Ccdc7a UTSW 8 128787338 missense probably damaging 0.97
R6366:Ccdc7a UTSW 8 128855992 missense unknown
R6455:Ccdc7a UTSW 8 128832610 missense probably damaging 0.97
R6882:Ccdc7a UTSW 8 128797328 intron probably benign
R6891:Ccdc7a UTSW 8 129026638 missense probably damaging 1.00
R6906:Ccdc7a UTSW 8 128935681 missense unknown
R7028:Ccdc7a UTSW 8 128881594 missense unknown
R7046:Ccdc7a UTSW 8 129047619 missense probably damaging 0.99
R7073:Ccdc7a UTSW 8 128892385 missense possibly damaging 0.46
R7268:Ccdc7a UTSW 8 128881152 missense possibly damaging 0.66
R7454:Ccdc7a UTSW 8 128944516 missense unknown
R7643:Ccdc7a UTSW 8 128889811 missense probably damaging 1.00
R7733:Ccdc7a UTSW 8 128993052 missense probably damaging 1.00
R7792:Ccdc7a UTSW 8 128892437 missense possibly damaging 0.81
R7902:Ccdc7a UTSW 8 128836173 missense possibly damaging 0.46
R7985:Ccdc7a UTSW 8 128836173 missense possibly damaging 0.46
R8032:Ccdc7a UTSW 8 128825383 missense unknown
RF008:Ccdc7a UTSW 8 128964953 missense probably damaging 0.99
Z1176:Ccdc7a UTSW 8 129026663 missense probably benign 0.41
Z1177:Ccdc7a UTSW 8 128807924 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- ATGGTGGGCTCATAATATAGGCTG -3'
(R):5'- GCTGGGCATTAGAGAAGATTGATC -3'

Sequencing Primer
(F):5'- GTTTGTTGGAAGAGCCCATCCATAAG -3'
(R):5'- ACTGAGAGAATTGGCCTCTTCCAG -3'
Posted On2018-08-29