Incidental Mutation 'R6778:Dlat'
ID531378
Institutional Source Beutler Lab
Gene Symbol Dlat
Ensembl Gene ENSMUSG00000000168
Gene Namedihydrolipoamide S-acetyltransferase (E2 component of pyruvate dehydrogenase complex)
SynonymsPDC-E2, 6332404G05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6778 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location50634633-50659780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50650857 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 289 (L289P)
Ref Sequence ENSEMBL: ENSMUSP00000034567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034567]
Predicted Effect probably damaging
Transcript: ENSMUST00000034567
AA Change: L289P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034567
Gene: ENSMUSG00000000168
AA Change: L289P

DomainStartEndE-ValueType
Pfam:Biotin_lipoyl 91 164 4.3e-17 PFAM
low complexity region 183 210 N/A INTRINSIC
Pfam:Biotin_lipoyl 218 292 1.2e-17 PFAM
low complexity region 315 344 N/A INTRINSIC
Pfam:E3_binding 350 385 2.6e-18 PFAM
Pfam:2-oxoacid_dh 412 642 9.9e-82 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes component E2 of the multi-enzyme pyruvate dehydrogenase complex (PDC). PDC resides in the inner mitochondrial membrane and catalyzes the conversion of pyruvate to acetyl coenzyme A. The protein product of this gene, dihydrolipoamide acetyltransferase, accepts acetyl groups formed by the oxidative decarboxylation of pyruvate and transfers them to coenzyme A. Dihydrolipoamide acetyltransferase is the antigen for antimitochondrial antibodies. These autoantibodies are present in nearly 95% of patients with the autoimmune liver disease primary biliary cirrhosis (PBC). In PBC, activated T lymphocytes attack and destroy epithelial cells in the bile duct where this protein is abnormally distributed and overexpressed. PBC enventually leads to cirrhosis and liver failure. Mutations in this gene are also a cause of pyruvate dehydrogenase E2 deficiency which causes primary lactic acidosis in infancy and early childhood.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts14 T A 10: 61,225,452 N403Y probably damaging Het
Akap6 A G 12: 53,025,816 E989G probably damaging Het
Aoc2 A G 11: 101,325,361 N90S probably damaging Het
Apol9a T C 15: 77,404,333 Y278C probably benign Het
Casq2 T A 3: 102,127,931 probably null Het
Ccdc7a T A 8: 128,821,120 T1284S possibly damaging Het
Dnah8 C T 17: 30,635,666 P101S probably benign Het
Dzip3 C A 16: 48,982,083 A28S probably benign Het
Fam205c T C 4: 42,868,522 K367R possibly damaging Het
Ffar4 A G 19: 38,113,664 E249G possibly damaging Het
Fubp3 A T 2: 31,598,673 K180N possibly damaging Het
Gm7489 T A 15: 53,885,952 probably benign Het
Ifitm6 A T 7: 141,016,143 M59K possibly damaging Het
Igkv4-80 A T 6: 69,016,561 Y115* probably null Het
Igsf21 G T 4: 140,034,648 R240S probably benign Het
Kank4 A T 4: 98,761,505 N942K probably benign Het
Man2a1 C A 17: 64,714,635 T35K possibly damaging Het
Mvk T A 5: 114,452,380 D193E probably benign Het
Npas2 T A 1: 39,325,300 M241K possibly damaging Het
Npsr1 T A 9: 24,254,618 I100N possibly damaging Het
Olfml2b A G 1: 170,645,070 D50G probably damaging Het
Olfr961 T A 9: 39,646,747 V7E probably damaging Het
Pcnx A G 12: 81,918,871 D604G probably damaging Het
Pitx2 C T 3: 129,218,743 P254L probably damaging Het
Rdh10 T C 1: 16,106,184 F56S probably damaging Het
Rin1 T C 19: 5,054,886 L647P probably damaging Het
Sgk3 T A 1: 9,886,144 probably null Het
Sgpp1 A G 12: 75,716,294 I371T probably benign Het
Slc12a9 T C 5: 137,315,081 Y872C possibly damaging Het
Syne1 A G 10: 5,102,406 F7487L probably damaging Het
Tars T C 15: 11,389,699 N375S probably benign Het
Tbc1d31 A G 15: 57,938,029 Y320C probably damaging Het
Tbl1xr1 T A 3: 22,189,782 F73L probably benign Het
Tmem145 G A 7: 25,311,376 V378I probably benign Het
Tmprss11d T C 5: 86,309,350 H150R probably benign Het
Tnc T G 4: 63,995,598 I1326L probably benign Het
Trpc7 T C 13: 56,804,687 Y502C probably damaging Het
Usp32 T C 11: 85,025,686 I811V probably benign Het
Vmn1r71 C T 7: 10,748,216 A182T probably benign Het
Wdr47 T A 3: 108,633,096 N602K probably benign Het
Other mutations in Dlat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Dlat APN 9 50645032 splice site probably benign
IGL00870:Dlat APN 9 50650869 missense probably damaging 1.00
R0440:Dlat UTSW 9 50645119 splice site probably null
R0530:Dlat UTSW 9 50637569 missense probably damaging 1.00
R0745:Dlat UTSW 9 50653708 missense probably damaging 0.99
R1870:Dlat UTSW 9 50637574 missense probably damaging 0.99
R3237:Dlat UTSW 9 50638031 missense possibly damaging 0.81
R3696:Dlat UTSW 9 50650876 missense possibly damaging 0.63
R3715:Dlat UTSW 9 50638054 missense probably damaging 1.00
R3924:Dlat UTSW 9 50658190 missense possibly damaging 0.55
R4016:Dlat UTSW 9 50649631 critical splice donor site probably null
R4197:Dlat UTSW 9 50636526 missense probably damaging 1.00
R4713:Dlat UTSW 9 50644481 missense probably benign
R4789:Dlat UTSW 9 50659370 missense probably benign
R5893:Dlat UTSW 9 50644139 splice site probably benign
R6138:Dlat UTSW 9 50645117 splice site probably null
R7010:Dlat UTSW 9 50657974 missense probably damaging 1.00
R8065:Dlat UTSW 9 50657849 missense possibly damaging 0.67
U15987:Dlat UTSW 9 50645117 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCCTTCGTGTAGGATCTGGACAC -3'
(R):5'- TTAGGGATGCAGGACCTGTG -3'

Sequencing Primer
(F):5'- CCCAGGAACCTGAGCTATTATCTG -3'
(R):5'- ATCCGTAACGAGATCTGGCTC -3'
Posted On2018-08-29