Mutagenetix > Incidental Mutations

Incidental Mutation 'R6778:Adamts14'

531380

Institutional Source

Beutler Lab

Gene Symbol

Adamts14

Ensembl Gene

ENSMUSG00000059901

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 14

Synonyms

Adamts-14, TS14

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6778 (G1)

Quality Score

183.009

Status

Not validated

Chromosome

Chromosomal Location

61197112-61273438 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 61225452 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 403 (N403Y)

Ref Sequence

ENSEMBL: ENSMUSP00000112723 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092486] [ENSMUST00000120336]

Predicted Effect

probably damaging
Transcript: ENSMUST00000092486
AA Change: N400Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000090143
Gene: ENSMUSG00000059901
AA Change: N400Y

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:Pep_M12B_propep	38	194	6.3e-30	PFAM
Pfam:Reprolysin_5	245	424	6e-17	PFAM
Pfam:Reprolysin_4	246	432	2.5e-7	PFAM
Pfam:Reprolysin	246	447	1.9e-21	PFAM
Pfam:Reprolysin_2	264	437	9.2e-10	PFAM
Pfam:Reprolysin_3	268	396	2.5e-12	PFAM
TSP1	542	594	5.9e-16	SMART
Pfam:ADAM_spacer1	701	816	1.8e-24	PFAM
TSP1	837	894	2.1e-2	SMART
TSP1	897	956	3.42e-3	SMART
TSP1	959	1009	4.48e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000120336
AA Change: N403Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112723
Gene: ENSMUSG00000059901
AA Change: N403Y

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:Pep_M12B_propep	39	194	1.6e-38	PFAM
Pfam:Reprolysin_5	245	427	5.9e-16	PFAM
Pfam:Reprolysin_4	246	435	1.1e-7	PFAM
Pfam:Reprolysin	246	450	3.2e-20	PFAM
Pfam:Reprolysin_2	264	441	5.5e-12	PFAM
Pfam:Reprolysin_3	268	399	1.5e-13	PFAM
TSP1	545	597	5.9e-16	SMART
Pfam:ADAM_spacer1	704	819	8e-25	PFAM
TSP1	840	897	2.1e-2	SMART
TSP1	900	959	3.42e-3	SMART
TSP1	962	1012	4.48e-7	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme cleaves amino-terminal propeptides from type I procollagen, a necessary step in the formation of collagen fibers. Mutations in this gene may be associated with osteoarthritis in human patients. [provided by RefSeq, May 2016]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap6	A	G	12: 53,025,816	E989G	probably damaging	Het
Aoc2	A	G	11: 101,325,361	N90S	probably damaging	Het
Apol9a	T	C	15: 77,404,333	Y278C	probably benign	Het
Casq2	T	A	3: 102,127,931		probably null	Het
Ccdc7a	T	A	8: 128,821,120	T1284S	possibly damaging	Het
Dlat	A	G	9: 50,650,857	L289P	probably damaging	Het
Dnah8	C	T	17: 30,635,666	P101S	probably benign	Het
Dzip3	C	A	16: 48,982,083	A28S	probably benign	Het
Fam205c	T	C	4: 42,868,522	K367R	possibly damaging	Het
Ffar4	A	G	19: 38,113,664	E249G	possibly damaging	Het
Fubp3	A	T	2: 31,598,673	K180N	possibly damaging	Het
Gm7489	T	A	15: 53,885,952		probably benign	Het
Ifitm6	A	T	7: 141,016,143	M59K	possibly damaging	Het
Igkv4-80	A	T	6: 69,016,561	Y115*	probably null	Het
Igsf21	G	T	4: 140,034,648	R240S	probably benign	Het
Kank4	A	T	4: 98,761,505	N942K	probably benign	Het
Man2a1	C	A	17: 64,714,635	T35K	possibly damaging	Het
Mvk	T	A	5: 114,452,380	D193E	probably benign	Het
Npas2	T	A	1: 39,325,300	M241K	possibly damaging	Het
Npsr1	T	A	9: 24,254,618	I100N	possibly damaging	Het
Olfml2b	A	G	1: 170,645,070	D50G	probably damaging	Het
Olfr961	T	A	9: 39,646,747	V7E	probably damaging	Het
Pcnx	A	G	12: 81,918,871	D604G	probably damaging	Het
Pitx2	C	T	3: 129,218,743	P254L	probably damaging	Het
Rdh10	T	C	1: 16,106,184	F56S	probably damaging	Het
Rin1	T	C	19: 5,054,886	L647P	probably damaging	Het
Sgk3	T	A	1: 9,886,144		probably null	Het
Sgpp1	A	G	12: 75,716,294	I371T	probably benign	Het
Slc12a9	T	C	5: 137,315,081	Y872C	possibly damaging	Het
Syne1	A	G	10: 5,102,406	F7487L	probably damaging	Het
Tars	T	C	15: 11,389,699	N375S	probably benign	Het
Tbc1d31	A	G	15: 57,938,029	Y320C	probably damaging	Het
Tbl1xr1	T	A	3: 22,189,782	F73L	probably benign	Het
Tmem145	G	A	7: 25,311,376	V378I	probably benign	Het
Tmprss11d	T	C	5: 86,309,350	H150R	probably benign	Het
Tnc	T	G	4: 63,995,598	I1326L	probably benign	Het
Trpc7	T	C	13: 56,804,687	Y502C	probably damaging	Het
Usp32	T	C	11: 85,025,686	I811V	probably benign	Het
Vmn1r71	C	T	7: 10,748,216	A182T	probably benign	Het
Wdr47	T	A	3: 108,633,096	N602K	probably benign	Het

Other mutations in Adamts14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Adamts14	APN	10	61229676	missense	probably damaging	1.00
IGL00800:Adamts14	APN	10	61205418	missense	probably benign	0.00
IGL01021:Adamts14	APN	10	61225373	missense	probably damaging	0.99
IGL01022:Adamts14	APN	10	61202942	missense	probably benign	0.01
IGL01335:Adamts14	APN	10	61198681	missense	possibly damaging	0.90
IGL01419:Adamts14	APN	10	61205542	splice site	probably benign
IGL01595:Adamts14	APN	10	61205473	missense	probably damaging	1.00
R0594:Adamts14	UTSW	10	61202887	missense	probably damaging	1.00
R0629:Adamts14	UTSW	10	61211624	nonsense	probably null
R1459:Adamts14	UTSW	10	61198804	missense	probably benign	0.13
R1565:Adamts14	UTSW	10	61270897	missense	probably damaging	1.00
R1686:Adamts14	UTSW	10	61198660	missense	probably benign
R1792:Adamts14	UTSW	10	61218498	missense	probably benign	0.07
R1876:Adamts14	UTSW	10	61200372	missense	probably benign	0.03
R1992:Adamts14	UTSW	10	61198660	missense	probably benign
R2064:Adamts14	UTSW	10	61205522	missense	probably benign	0.24
R2495:Adamts14	UTSW	10	61198970	splice site	probably null
R2848:Adamts14	UTSW	10	61218435	missense	probably damaging	1.00
R2897:Adamts14	UTSW	10	61204910	missense	probably damaging	0.99
R3428:Adamts14	UTSW	10	61224374	missense	probably benign	0.36
R4006:Adamts14	UTSW	10	61202821	critical splice donor site	probably null
R5129:Adamts14	UTSW	10	61249618	missense	probably benign	0.02
R5327:Adamts14	UTSW	10	61198488	missense	probably benign	0.01
R5524:Adamts14	UTSW	10	61230443	missense	probably damaging	1.00
R5594:Adamts14	UTSW	10	61227101	splice site	probably null
R5694:Adamts14	UTSW	10	61229652	missense	probably benign	0.45
R5801:Adamts14	UTSW	10	61202996	missense	probably damaging	0.99
R5941:Adamts14	UTSW	10	61221895	missense	probably damaging	1.00
R5953:Adamts14	UTSW	10	61207446	missense	probably damaging	0.99
R7169:Adamts14	UTSW	10	61204928	missense	probably damaging	0.97
R7215:Adamts14	UTSW	10	61211596	missense	possibly damaging	0.89
R7337:Adamts14	UTSW	10	61207460	missense	probably damaging	0.98
R7511:Adamts14	UTSW	10	61218528	missense	possibly damaging	0.74
R7640:Adamts14	UTSW	10	61246057	missense	probably benign	0.00
R7798:Adamts14	UTSW	10	61271173	missense	probably damaging	0.99
R7902:Adamts14	UTSW	10	61205397	missense	possibly damaging	0.92
R7985:Adamts14	UTSW	10	61205397	missense	possibly damaging	0.92
R8062:Adamts14	UTSW	10	61200361	critical splice donor site	probably null
Z1088:Adamts14	UTSW	10	61218445	missense	probably damaging	1.00
Z1177:Adamts14	UTSW	10	61198843	missense	possibly damaging	0.69

Predicted Primers

PCR Primer
(F):5'- AGACACAGAGTGACCAGGCC -3'
(R):5'- TGAGGGAAGGATGGGTCTCC -3'

Sequencing Primer
(F):5'- CCGGACAGGACAGCTGTGTAG -3'
(R):5'- TCTCCAGAGGGAAAGAACATG -3'

Posted On

2018-08-29