Incidental Mutation 'R6778:Adamts14'
ID531380
Institutional Source Beutler Lab
Gene Symbol Adamts14
Ensembl Gene ENSMUSG00000059901
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 14
SynonymsAdamts-14, TS14
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6778 (G1)
Quality Score183.009
Status Not validated
Chromosome10
Chromosomal Location61197112-61273438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 61225452 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 403 (N403Y)
Ref Sequence ENSEMBL: ENSMUSP00000112723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092486] [ENSMUST00000120336]
Predicted Effect probably damaging
Transcript: ENSMUST00000092486
AA Change: N400Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090143
Gene: ENSMUSG00000059901
AA Change: N400Y

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Pep_M12B_propep 38 194 6.3e-30 PFAM
Pfam:Reprolysin_5 245 424 6e-17 PFAM
Pfam:Reprolysin_4 246 432 2.5e-7 PFAM
Pfam:Reprolysin 246 447 1.9e-21 PFAM
Pfam:Reprolysin_2 264 437 9.2e-10 PFAM
Pfam:Reprolysin_3 268 396 2.5e-12 PFAM
TSP1 542 594 5.9e-16 SMART
Pfam:ADAM_spacer1 701 816 1.8e-24 PFAM
TSP1 837 894 2.1e-2 SMART
TSP1 897 956 3.42e-3 SMART
TSP1 959 1009 4.48e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120336
AA Change: N403Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112723
Gene: ENSMUSG00000059901
AA Change: N403Y

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 194 1.6e-38 PFAM
Pfam:Reprolysin_5 245 427 5.9e-16 PFAM
Pfam:Reprolysin_4 246 435 1.1e-7 PFAM
Pfam:Reprolysin 246 450 3.2e-20 PFAM
Pfam:Reprolysin_2 264 441 5.5e-12 PFAM
Pfam:Reprolysin_3 268 399 1.5e-13 PFAM
TSP1 545 597 5.9e-16 SMART
Pfam:ADAM_spacer1 704 819 8e-25 PFAM
TSP1 840 897 2.1e-2 SMART
TSP1 900 959 3.42e-3 SMART
TSP1 962 1012 4.48e-7 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme cleaves amino-terminal propeptides from type I procollagen, a necessary step in the formation of collagen fibers. Mutations in this gene may be associated with osteoarthritis in human patients. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 A G 12: 53,025,816 E989G probably damaging Het
Aoc2 A G 11: 101,325,361 N90S probably damaging Het
Apol9a T C 15: 77,404,333 Y278C probably benign Het
Casq2 T A 3: 102,127,931 probably null Het
Ccdc7a T A 8: 128,821,120 T1284S possibly damaging Het
Dlat A G 9: 50,650,857 L289P probably damaging Het
Dnah8 C T 17: 30,635,666 P101S probably benign Het
Dzip3 C A 16: 48,982,083 A28S probably benign Het
Fam205c T C 4: 42,868,522 K367R possibly damaging Het
Ffar4 A G 19: 38,113,664 E249G possibly damaging Het
Fubp3 A T 2: 31,598,673 K180N possibly damaging Het
Gm7489 T A 15: 53,885,952 probably benign Het
Ifitm6 A T 7: 141,016,143 M59K possibly damaging Het
Igkv4-80 A T 6: 69,016,561 Y115* probably null Het
Igsf21 G T 4: 140,034,648 R240S probably benign Het
Kank4 A T 4: 98,761,505 N942K probably benign Het
Man2a1 C A 17: 64,714,635 T35K possibly damaging Het
Mvk T A 5: 114,452,380 D193E probably benign Het
Npas2 T A 1: 39,325,300 M241K possibly damaging Het
Npsr1 T A 9: 24,254,618 I100N possibly damaging Het
Olfml2b A G 1: 170,645,070 D50G probably damaging Het
Olfr961 T A 9: 39,646,747 V7E probably damaging Het
Pcnx A G 12: 81,918,871 D604G probably damaging Het
Pitx2 C T 3: 129,218,743 P254L probably damaging Het
Rdh10 T C 1: 16,106,184 F56S probably damaging Het
Rin1 T C 19: 5,054,886 L647P probably damaging Het
Sgk3 T A 1: 9,886,144 probably null Het
Sgpp1 A G 12: 75,716,294 I371T probably benign Het
Slc12a9 T C 5: 137,315,081 Y872C possibly damaging Het
Syne1 A G 10: 5,102,406 F7487L probably damaging Het
Tars T C 15: 11,389,699 N375S probably benign Het
Tbc1d31 A G 15: 57,938,029 Y320C probably damaging Het
Tbl1xr1 T A 3: 22,189,782 F73L probably benign Het
Tmem145 G A 7: 25,311,376 V378I probably benign Het
Tmprss11d T C 5: 86,309,350 H150R probably benign Het
Tnc T G 4: 63,995,598 I1326L probably benign Het
Trpc7 T C 13: 56,804,687 Y502C probably damaging Het
Usp32 T C 11: 85,025,686 I811V probably benign Het
Vmn1r71 C T 7: 10,748,216 A182T probably benign Het
Wdr47 T A 3: 108,633,096 N602K probably benign Het
Other mutations in Adamts14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Adamts14 APN 10 61229676 missense probably damaging 1.00
IGL00800:Adamts14 APN 10 61205418 missense probably benign 0.00
IGL01021:Adamts14 APN 10 61225373 missense probably damaging 0.99
IGL01022:Adamts14 APN 10 61202942 missense probably benign 0.01
IGL01335:Adamts14 APN 10 61198681 missense possibly damaging 0.90
IGL01419:Adamts14 APN 10 61205542 splice site probably benign
IGL01595:Adamts14 APN 10 61205473 missense probably damaging 1.00
R0594:Adamts14 UTSW 10 61202887 missense probably damaging 1.00
R0629:Adamts14 UTSW 10 61211624 nonsense probably null
R1459:Adamts14 UTSW 10 61198804 missense probably benign 0.13
R1565:Adamts14 UTSW 10 61270897 missense probably damaging 1.00
R1686:Adamts14 UTSW 10 61198660 missense probably benign
R1792:Adamts14 UTSW 10 61218498 missense probably benign 0.07
R1876:Adamts14 UTSW 10 61200372 missense probably benign 0.03
R1992:Adamts14 UTSW 10 61198660 missense probably benign
R2064:Adamts14 UTSW 10 61205522 missense probably benign 0.24
R2495:Adamts14 UTSW 10 61198970 splice site probably null
R2848:Adamts14 UTSW 10 61218435 missense probably damaging 1.00
R2897:Adamts14 UTSW 10 61204910 missense probably damaging 0.99
R3428:Adamts14 UTSW 10 61224374 missense probably benign 0.36
R4006:Adamts14 UTSW 10 61202821 critical splice donor site probably null
R5129:Adamts14 UTSW 10 61249618 missense probably benign 0.02
R5327:Adamts14 UTSW 10 61198488 missense probably benign 0.01
R5524:Adamts14 UTSW 10 61230443 missense probably damaging 1.00
R5594:Adamts14 UTSW 10 61227101 splice site probably null
R5694:Adamts14 UTSW 10 61229652 missense probably benign 0.45
R5801:Adamts14 UTSW 10 61202996 missense probably damaging 0.99
R5941:Adamts14 UTSW 10 61221895 missense probably damaging 1.00
R5953:Adamts14 UTSW 10 61207446 missense probably damaging 0.99
R7169:Adamts14 UTSW 10 61204928 missense probably damaging 0.97
R7215:Adamts14 UTSW 10 61211596 missense possibly damaging 0.89
R7337:Adamts14 UTSW 10 61207460 missense probably damaging 0.98
R7511:Adamts14 UTSW 10 61218528 missense possibly damaging 0.74
R7640:Adamts14 UTSW 10 61246057 missense probably benign 0.00
R7798:Adamts14 UTSW 10 61271173 missense probably damaging 0.99
R7902:Adamts14 UTSW 10 61205397 missense possibly damaging 0.92
R7985:Adamts14 UTSW 10 61205397 missense possibly damaging 0.92
R8062:Adamts14 UTSW 10 61200361 critical splice donor site probably null
Z1088:Adamts14 UTSW 10 61218445 missense probably damaging 1.00
Z1177:Adamts14 UTSW 10 61198843 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- AGACACAGAGTGACCAGGCC -3'
(R):5'- TGAGGGAAGGATGGGTCTCC -3'

Sequencing Primer
(F):5'- CCGGACAGGACAGCTGTGTAG -3'
(R):5'- TCTCCAGAGGGAAAGAACATG -3'
Posted On2018-08-29