Mutagenetix > Incidental Mutations

Incidental Mutation 'R6778:Usp32'

531381

Institutional Source

Beutler Lab

Gene Symbol

Usp32

Ensembl Gene

ENSMUSG00000000804

Gene Name

ubiquitin specific peptidase 32

Synonyms

6430526O11Rik, 2900074J03Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6778 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

84984442-85140161 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 85025686 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 811 (I811V)

Ref Sequence

ENSEMBL: ENSMUSP00000103710 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000108075]

Predicted Effect

unknown
Transcript: ENSMUST00000000821
AA Change: I109V

SMART Domains

Protein: ENSMUSP00000000821
Gene: ENSMUSG00000000804
AA Change: I109V

Domain	Start	End	E-Value	Type
Pfam:UCH	32	260	4.1e-51	PFAM
Pfam:UCH_1	33	228	1.7e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108075
AA Change: I811V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804
AA Change: I811V

Domain	Start	End	E-Value	Type
EFh	232	260	4.66e0	SMART
EFh	268	296	5.8e-1	SMART
Blast:EFh	318	346	5e-7	BLAST
DUSP	389	588	2.32e-16	SMART
Pfam:Ubiquitin_3	628	711	2.4e-9	PFAM
Pfam:UCH	733	1564	2.4e-83	PFAM
Pfam:UCH_1	1202	1547	2.9e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000174602

SMART Domains

Protein: ENSMUSP00000134476
Gene: ENSMUSG00000000804

Domain	Start	End	E-Value	Type
Pfam:DUSP	1	65	6.5e-17	PFAM
Pfam:Ubiquitin_3	122	216	8e-10	PFAM
Pfam:UCH	238	257	1.2e-7	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts14	T	A	10: 61,225,452	N403Y	probably damaging	Het
Akap6	A	G	12: 53,025,816	E989G	probably damaging	Het
Aoc2	A	G	11: 101,325,361	N90S	probably damaging	Het
Apol9a	T	C	15: 77,404,333	Y278C	probably benign	Het
Casq2	T	A	3: 102,127,931		probably null	Het
Ccdc7a	T	A	8: 128,821,120	T1284S	possibly damaging	Het
Dlat	A	G	9: 50,650,857	L289P	probably damaging	Het
Dnah8	C	T	17: 30,635,666	P101S	probably benign	Het
Dzip3	C	A	16: 48,982,083	A28S	probably benign	Het
Fam205c	T	C	4: 42,868,522	K367R	possibly damaging	Het
Ffar4	A	G	19: 38,113,664	E249G	possibly damaging	Het
Fubp3	A	T	2: 31,598,673	K180N	possibly damaging	Het
Gm7489	T	A	15: 53,885,952		probably benign	Het
Ifitm6	A	T	7: 141,016,143	M59K	possibly damaging	Het
Igkv4-80	A	T	6: 69,016,561	Y115*	probably null	Het
Igsf21	G	T	4: 140,034,648	R240S	probably benign	Het
Kank4	A	T	4: 98,761,505	N942K	probably benign	Het
Man2a1	C	A	17: 64,714,635	T35K	possibly damaging	Het
Mvk	T	A	5: 114,452,380	D193E	probably benign	Het
Npas2	T	A	1: 39,325,300	M241K	possibly damaging	Het
Npsr1	T	A	9: 24,254,618	I100N	possibly damaging	Het
Olfml2b	A	G	1: 170,645,070	D50G	probably damaging	Het
Olfr961	T	A	9: 39,646,747	V7E	probably damaging	Het
Pcnx	A	G	12: 81,918,871	D604G	probably damaging	Het
Pitx2	C	T	3: 129,218,743	P254L	probably damaging	Het
Rdh10	T	C	1: 16,106,184	F56S	probably damaging	Het
Rin1	T	C	19: 5,054,886	L647P	probably damaging	Het
Sgk3	T	A	1: 9,886,144		probably null	Het
Sgpp1	A	G	12: 75,716,294	I371T	probably benign	Het
Slc12a9	T	C	5: 137,315,081	Y872C	possibly damaging	Het
Syne1	A	G	10: 5,102,406	F7487L	probably damaging	Het
Tars	T	C	15: 11,389,699	N375S	probably benign	Het
Tbc1d31	A	G	15: 57,938,029	Y320C	probably damaging	Het
Tbl1xr1	T	A	3: 22,189,782	F73L	probably benign	Het
Tmem145	G	A	7: 25,311,376	V378I	probably benign	Het
Tmprss11d	T	C	5: 86,309,350	H150R	probably benign	Het
Tnc	T	G	4: 63,995,598	I1326L	probably benign	Het
Trpc7	T	C	13: 56,804,687	Y502C	probably damaging	Het
Vmn1r71	C	T	7: 10,748,216	A182T	probably benign	Het
Wdr47	T	A	3: 108,633,096	N602K	probably benign	Het

Other mutations in Usp32

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00529:Usp32	APN	11	84994426	missense	probably damaging	1.00
IGL00701:Usp32	APN	11	85059125	splice site	probably null
IGL00848:Usp32	APN	11	85051181	splice site	probably benign
IGL00934:Usp32	APN	11	85007076	missense	probably damaging	1.00
IGL01019:Usp32	APN	11	85039265	missense	probably damaging	0.97
IGL01302:Usp32	APN	11	84988482	missense	probably benign	0.05
IGL01444:Usp32	APN	11	85059164	missense	probably damaging	0.97
IGL01575:Usp32	APN	11	85022802	missense	probably damaging	1.00
IGL01981:Usp32	APN	11	85036524	missense	probably benign	0.02
IGL02118:Usp32	APN	11	85032177	nonsense	probably null
IGL02159:Usp32	APN	11	85005802	splice site	probably null
IGL02227:Usp32	APN	11	84986481	missense	probably damaging	1.00
IGL02363:Usp32	APN	11	85044787	missense	probably benign	0.01
IGL02524:Usp32	APN	11	85010011	nonsense	probably null
IGL02613:Usp32	APN	11	85040070	missense	probably damaging	0.99
IGL02720:Usp32	APN	11	85006991	critical splice donor site	probably null
IGL02738:Usp32	APN	11	85083806	missense	probably damaging	1.00
IGL02929:Usp32	APN	11	84988372	missense	probably benign	0.01
IGL03303:Usp32	APN	11	85022832	missense	probably damaging	1.00
BB010:Usp32	UTSW	11	85007059	missense	probably damaging	1.00
BB020:Usp32	UTSW	11	85007059	missense	probably damaging	1.00
PIT4812001:Usp32	UTSW	11	85010074	missense	probably damaging	1.00
R0026:Usp32	UTSW	11	85032074	missense	possibly damaging	0.48
R0295:Usp32	UTSW	11	85053692	missense	probably damaging	0.98
R1320:Usp32	UTSW	11	85017793	missense	probably damaging	0.98
R1712:Usp32	UTSW	11	85042580	missense	probably benign	0.12
R1922:Usp32	UTSW	11	85007004	nonsense	probably null
R1973:Usp32	UTSW	11	85103931	missense	probably benign	0.09
R2010:Usp32	UTSW	11	85040004	missense	probably damaging	0.98
R2082:Usp32	UTSW	11	85030512	missense	probably damaging	0.99
R2355:Usp32	UTSW	11	85005909	missense	probably benign	0.34
R3147:Usp32	UTSW	11	85029087	missense	probably damaging	1.00
R3160:Usp32	UTSW	11	85025536	missense	probably damaging	0.97
R3162:Usp32	UTSW	11	85025536	missense	probably damaging	0.97
R3716:Usp32	UTSW	11	85042563	missense	probably damaging	1.00
R3816:Usp32	UTSW	11	84994384	critical splice donor site	probably null
R3870:Usp32	UTSW	11	85007055	nonsense	probably null
R3871:Usp32	UTSW	11	85081156	missense	probably null	0.81
R4041:Usp32	UTSW	11	85017739	missense	probably benign	0.40
R4079:Usp32	UTSW	11	85039229	missense	probably damaging	0.98
R4332:Usp32	UTSW	11	85103978	missense	possibly damaging	0.79
R4396:Usp32	UTSW	11	85053975	missense	probably benign
R4580:Usp32	UTSW	11	85059127	critical splice donor site	probably null
R4620:Usp32	UTSW	11	85059127	critical splice donor site	probably null
R4744:Usp32	UTSW	11	84994393	missense	probably damaging	1.00
R4909:Usp32	UTSW	11	85055772	nonsense	probably null
R5056:Usp32	UTSW	11	85026795	missense	probably benign	0.07
R5111:Usp32	UTSW	11	85077331	missense	possibly damaging	0.95
R5213:Usp32	UTSW	11	85022259	missense	probably damaging	1.00
R5308:Usp32	UTSW	11	85017718	missense	probably benign	0.12
R5381:Usp32	UTSW	11	85059127	critical splice donor site	probably benign
R5538:Usp32	UTSW	11	85017786	missense	possibly damaging	0.65
R5659:Usp32	UTSW	11	85077414	missense	possibly damaging	0.94
R6006:Usp32	UTSW	11	84992451	critical splice donor site	probably null
R6011:Usp32	UTSW	11	85032097	missense	possibly damaging	0.70
R6029:Usp32	UTSW	11	85025582	missense	probably damaging	0.99
R6074:Usp32	UTSW	11	84994573	missense	probably benign	0.00
R6331:Usp32	UTSW	11	84986576	missense	possibly damaging	0.92
R6353:Usp32	UTSW	11	85022281	missense	probably benign
R6714:Usp32	UTSW	11	85026870	missense	probably damaging	0.99
R6988:Usp32	UTSW	11	85010143	missense	probably benign	0.35
R6992:Usp32	UTSW	11	85032088	missense	probably damaging	0.99
R7182:Usp32	UTSW	11	85040170	missense	probably benign	0.34
R7186:Usp32	UTSW	11	85051234	missense	probably benign	0.45
R7198:Usp32	UTSW	11	85022855	frame shift	probably null
R7201:Usp32	UTSW	11	85022855	frame shift	probably null
R7469:Usp32	UTSW	11	84988553	missense	possibly damaging	0.94
R7502:Usp32	UTSW	11	85022898	missense	possibly damaging	0.48
R7513:Usp32	UTSW	11	85027112	nonsense	probably null
R7629:Usp32	UTSW	11	85019855	frame shift	probably null
R7703:Usp32	UTSW	11	85077327	missense	probably damaging	0.99
R7741:Usp32	UTSW	11	84987281	missense	probably damaging	0.99
R7765:Usp32	UTSW	11	84994408	missense	probably damaging	1.00
R7933:Usp32	UTSW	11	85007059	missense	probably damaging	1.00
R7973:Usp32	UTSW	11	85022808	missense	probably damaging	0.99
R7989:Usp32	UTSW	11	85034300	missense
R7998:Usp32	UTSW	11	84994426	missense	probably damaging	1.00
R8292:Usp32	UTSW	11	85077401	missense	probably damaging	0.99
R8305:Usp32	UTSW	11	85032185	missense	possibly damaging	0.83
R8548:Usp32	UTSW	11	85017827	missense	possibly damaging	0.52
X0028:Usp32	UTSW	11	84992606	missense	probably benign	0.05
Z1177:Usp32	UTSW	11	84988612	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCCAGCTAAGTAGGTAGAACACAAG -3'
(R):5'- GATGGTATCAATGGCCAAAATGC -3'

Sequencing Primer
(F):5'- TCAAAACTAACAAACCTCTGCAG -3'
(R):5'- GCCAAAATGCCTCTTATTTTTCTGG -3'

Posted On

2018-08-29