Incidental Mutation 'R6778:Usp32'
ID531381
Institutional Source Beutler Lab
Gene Symbol Usp32
Ensembl Gene ENSMUSG00000000804
Gene Nameubiquitin specific peptidase 32
Synonyms6430526O11Rik, 2900074J03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6778 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location84984442-85140161 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85025686 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 811 (I811V)
Ref Sequence ENSEMBL: ENSMUSP00000103710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108075]
Predicted Effect unknown
Transcript: ENSMUST00000000821
AA Change: I109V
SMART Domains Protein: ENSMUSP00000000821
Gene: ENSMUSG00000000804
AA Change: I109V

DomainStartEndE-ValueType
Pfam:UCH 32 260 4.1e-51 PFAM
Pfam:UCH_1 33 228 1.7e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108075
AA Change: I811V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804
AA Change: I811V

DomainStartEndE-ValueType
EFh 232 260 4.66e0 SMART
EFh 268 296 5.8e-1 SMART
Blast:EFh 318 346 5e-7 BLAST
DUSP 389 588 2.32e-16 SMART
Pfam:Ubiquitin_3 628 711 2.4e-9 PFAM
Pfam:UCH 733 1564 2.4e-83 PFAM
Pfam:UCH_1 1202 1547 2.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174602
SMART Domains Protein: ENSMUSP00000134476
Gene: ENSMUSG00000000804

DomainStartEndE-ValueType
Pfam:DUSP 1 65 6.5e-17 PFAM
Pfam:Ubiquitin_3 122 216 8e-10 PFAM
Pfam:UCH 238 257 1.2e-7 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts14 T A 10: 61,225,452 N403Y probably damaging Het
Akap6 A G 12: 53,025,816 E989G probably damaging Het
Aoc2 A G 11: 101,325,361 N90S probably damaging Het
Apol9a T C 15: 77,404,333 Y278C probably benign Het
Casq2 T A 3: 102,127,931 probably null Het
Ccdc7a T A 8: 128,821,120 T1284S possibly damaging Het
Dlat A G 9: 50,650,857 L289P probably damaging Het
Dnah8 C T 17: 30,635,666 P101S probably benign Het
Dzip3 C A 16: 48,982,083 A28S probably benign Het
Fam205c T C 4: 42,868,522 K367R possibly damaging Het
Ffar4 A G 19: 38,113,664 E249G possibly damaging Het
Fubp3 A T 2: 31,598,673 K180N possibly damaging Het
Gm7489 T A 15: 53,885,952 probably benign Het
Ifitm6 A T 7: 141,016,143 M59K possibly damaging Het
Igkv4-80 A T 6: 69,016,561 Y115* probably null Het
Igsf21 G T 4: 140,034,648 R240S probably benign Het
Kank4 A T 4: 98,761,505 N942K probably benign Het
Man2a1 C A 17: 64,714,635 T35K possibly damaging Het
Mvk T A 5: 114,452,380 D193E probably benign Het
Npas2 T A 1: 39,325,300 M241K possibly damaging Het
Npsr1 T A 9: 24,254,618 I100N possibly damaging Het
Olfml2b A G 1: 170,645,070 D50G probably damaging Het
Olfr961 T A 9: 39,646,747 V7E probably damaging Het
Pcnx A G 12: 81,918,871 D604G probably damaging Het
Pitx2 C T 3: 129,218,743 P254L probably damaging Het
Rdh10 T C 1: 16,106,184 F56S probably damaging Het
Rin1 T C 19: 5,054,886 L647P probably damaging Het
Sgk3 T A 1: 9,886,144 probably null Het
Sgpp1 A G 12: 75,716,294 I371T probably benign Het
Slc12a9 T C 5: 137,315,081 Y872C possibly damaging Het
Syne1 A G 10: 5,102,406 F7487L probably damaging Het
Tars T C 15: 11,389,699 N375S probably benign Het
Tbc1d31 A G 15: 57,938,029 Y320C probably damaging Het
Tbl1xr1 T A 3: 22,189,782 F73L probably benign Het
Tmem145 G A 7: 25,311,376 V378I probably benign Het
Tmprss11d T C 5: 86,309,350 H150R probably benign Het
Tnc T G 4: 63,995,598 I1326L probably benign Het
Trpc7 T C 13: 56,804,687 Y502C probably damaging Het
Vmn1r71 C T 7: 10,748,216 A182T probably benign Het
Wdr47 T A 3: 108,633,096 N602K probably benign Het
Other mutations in Usp32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Usp32 APN 11 84994426 missense probably damaging 1.00
IGL00701:Usp32 APN 11 85059125 splice site probably null
IGL00848:Usp32 APN 11 85051181 splice site probably benign
IGL00934:Usp32 APN 11 85007076 missense probably damaging 1.00
IGL01019:Usp32 APN 11 85039265 missense probably damaging 0.97
IGL01302:Usp32 APN 11 84988482 missense probably benign 0.05
IGL01444:Usp32 APN 11 85059164 missense probably damaging 0.97
IGL01575:Usp32 APN 11 85022802 missense probably damaging 1.00
IGL01981:Usp32 APN 11 85036524 missense probably benign 0.02
IGL02118:Usp32 APN 11 85032177 nonsense probably null
IGL02159:Usp32 APN 11 85005802 splice site probably null
IGL02227:Usp32 APN 11 84986481 missense probably damaging 1.00
IGL02363:Usp32 APN 11 85044787 missense probably benign 0.01
IGL02524:Usp32 APN 11 85010011 nonsense probably null
IGL02613:Usp32 APN 11 85040070 missense probably damaging 0.99
IGL02720:Usp32 APN 11 85006991 critical splice donor site probably null
IGL02738:Usp32 APN 11 85083806 missense probably damaging 1.00
IGL02929:Usp32 APN 11 84988372 missense probably benign 0.01
IGL03303:Usp32 APN 11 85022832 missense probably damaging 1.00
PIT4812001:Usp32 UTSW 11 85010074 missense probably damaging 1.00
R0026:Usp32 UTSW 11 85032074 missense possibly damaging 0.48
R0295:Usp32 UTSW 11 85053692 missense probably damaging 0.98
R1320:Usp32 UTSW 11 85017793 missense probably damaging 0.98
R1712:Usp32 UTSW 11 85042580 missense probably benign 0.12
R1922:Usp32 UTSW 11 85007004 nonsense probably null
R1973:Usp32 UTSW 11 85103931 missense probably benign 0.09
R2010:Usp32 UTSW 11 85040004 missense probably damaging 0.98
R2082:Usp32 UTSW 11 85030512 missense probably damaging 0.99
R2355:Usp32 UTSW 11 85005909 missense probably benign 0.34
R3147:Usp32 UTSW 11 85029087 missense probably damaging 1.00
R3160:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3162:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3716:Usp32 UTSW 11 85042563 missense probably damaging 1.00
R3816:Usp32 UTSW 11 84994384 critical splice donor site probably null
R3870:Usp32 UTSW 11 85007055 nonsense probably null
R3871:Usp32 UTSW 11 85081156 missense probably null 0.81
R4041:Usp32 UTSW 11 85017739 missense probably benign 0.40
R4079:Usp32 UTSW 11 85039229 missense probably damaging 0.98
R4332:Usp32 UTSW 11 85103978 missense possibly damaging 0.79
R4396:Usp32 UTSW 11 85053975 missense probably benign
R4580:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4620:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4744:Usp32 UTSW 11 84994393 missense probably damaging 1.00
R4909:Usp32 UTSW 11 85055772 nonsense probably null
R5056:Usp32 UTSW 11 85026795 missense probably benign 0.07
R5111:Usp32 UTSW 11 85077331 missense possibly damaging 0.95
R5213:Usp32 UTSW 11 85022259 missense probably damaging 1.00
R5308:Usp32 UTSW 11 85017718 missense probably benign 0.12
R5381:Usp32 UTSW 11 85059127 critical splice donor site probably benign
R5538:Usp32 UTSW 11 85017786 missense possibly damaging 0.65
R5659:Usp32 UTSW 11 85077414 missense possibly damaging 0.94
R6006:Usp32 UTSW 11 84992451 critical splice donor site probably null
R6011:Usp32 UTSW 11 85032097 missense possibly damaging 0.70
R6029:Usp32 UTSW 11 85025582 missense probably damaging 0.99
R6074:Usp32 UTSW 11 84994573 missense probably benign 0.00
R6331:Usp32 UTSW 11 84986576 missense possibly damaging 0.92
R6353:Usp32 UTSW 11 85022281 missense probably benign
R6714:Usp32 UTSW 11 85026870 missense probably damaging 0.99
R6988:Usp32 UTSW 11 85010143 missense probably benign 0.35
R6992:Usp32 UTSW 11 85032088 missense probably damaging 0.99
R7182:Usp32 UTSW 11 85040170 missense probably benign 0.34
R7186:Usp32 UTSW 11 85051234 missense probably benign 0.45
R7198:Usp32 UTSW 11 85022855 frame shift probably null
R7201:Usp32 UTSW 11 85022855 frame shift probably null
R7469:Usp32 UTSW 11 84988553 missense possibly damaging 0.94
R7502:Usp32 UTSW 11 85022898 missense possibly damaging 0.48
R7513:Usp32 UTSW 11 85027112 nonsense probably null
R7629:Usp32 UTSW 11 85019855 frame shift probably null
R7703:Usp32 UTSW 11 85077327 missense probably damaging 0.99
R7741:Usp32 UTSW 11 84987281 missense probably damaging 0.99
R7765:Usp32 UTSW 11 84994408 missense probably damaging 1.00
R7998:Usp32 UTSW 11 84994426 missense probably damaging 1.00
X0028:Usp32 UTSW 11 84992606 missense probably benign 0.05
Z1177:Usp32 UTSW 11 84988612 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCAGCTAAGTAGGTAGAACACAAG -3'
(R):5'- GATGGTATCAATGGCCAAAATGC -3'

Sequencing Primer
(F):5'- TCAAAACTAACAAACCTCTGCAG -3'
(R):5'- GCCAAAATGCCTCTTATTTTTCTGG -3'
Posted On2018-08-29