Incidental Mutation 'R6778:Aoc2'
ID531382
Institutional Source Beutler Lab
Gene Symbol Aoc2
Ensembl Gene ENSMUSG00000078651
Gene Nameamine oxidase, copper containing 2 (retina-specific)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R6778 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location101325063-101329702 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101325361 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 90 (N90S)
Ref Sequence ENSEMBL: ENSMUSP00000040255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019470] [ENSMUST00000041095] [ENSMUST00000107264] [ENSMUST00000151385]
Predicted Effect probably benign
Transcript: ENSMUST00000019470
SMART Domains Protein: ENSMUSP00000019470
Gene: ENSMUSG00000078652

DomainStartEndE-ValueType
Pfam:PA28_alpha 9 69 2.9e-30 PFAM
Pfam:PA28_beta 108 252 3e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000041095
AA Change: N90S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000040255
Gene: ENSMUSG00000078651
AA Change: N90S

DomainStartEndE-ValueType
transmembrane domain 5 26 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 62 148 1.7e-29 PFAM
Pfam:Cu_amine_oxidN3 165 263 5.7e-22 PFAM
Pfam:Cu_amine_oxid 309 718 3.7e-110 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107264
AA Change: N90S

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102885
Gene: ENSMUSG00000078651
AA Change: N90S

DomainStartEndE-ValueType
transmembrane domain 5 26 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 62 148 8.2e-24 PFAM
Pfam:Cu_amine_oxidN3 165 263 9.9e-20 PFAM
Pfam:Cu_amine_oxid 308 605 5.9e-86 PFAM
Pfam:Cu_amine_oxid 600 694 7.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151385
SMART Domains Protein: ENSMUSP00000116996
Gene: ENSMUSG00000078652

DomainStartEndE-ValueType
Pfam:PA28_alpha 17 81 1.5e-32 PFAM
Pfam:PA28_beta 116 203 5.6e-40 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Copper amine oxidases catalyze the oxidative conversion of amines to aldehydes and ammonia in the presence of copper and quinone cofactor. This gene shows high sequence similarity to copper amine oxidases from various species ranging from bacteria to mammals. The protein contains several conserved motifs including the active site of amine oxidases and the histidine residues that likely bind copper. It may be a critical modulator of signal transmission in retina, possibly by degrading the biogenic amines dopamine, histamine, and putrescine. This gene may be a candidate gene for hereditary ocular diseases. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts14 T A 10: 61,225,452 N403Y probably damaging Het
Akap6 A G 12: 53,025,816 E989G probably damaging Het
Apol9a T C 15: 77,404,333 Y278C probably benign Het
Casq2 T A 3: 102,127,931 probably null Het
Ccdc7a T A 8: 128,821,120 T1284S possibly damaging Het
Dlat A G 9: 50,650,857 L289P probably damaging Het
Dnah8 C T 17: 30,635,666 P101S probably benign Het
Dzip3 C A 16: 48,982,083 A28S probably benign Het
Fam205c T C 4: 42,868,522 K367R possibly damaging Het
Ffar4 A G 19: 38,113,664 E249G possibly damaging Het
Fubp3 A T 2: 31,598,673 K180N possibly damaging Het
Gm7489 T A 15: 53,885,952 probably benign Het
Ifitm6 A T 7: 141,016,143 M59K possibly damaging Het
Igkv4-80 A T 6: 69,016,561 Y115* probably null Het
Igsf21 G T 4: 140,034,648 R240S probably benign Het
Kank4 A T 4: 98,761,505 N942K probably benign Het
Man2a1 C A 17: 64,714,635 T35K possibly damaging Het
Mvk T A 5: 114,452,380 D193E probably benign Het
Npas2 T A 1: 39,325,300 M241K possibly damaging Het
Npsr1 T A 9: 24,254,618 I100N possibly damaging Het
Olfml2b A G 1: 170,645,070 D50G probably damaging Het
Olfr961 T A 9: 39,646,747 V7E probably damaging Het
Pcnx A G 12: 81,918,871 D604G probably damaging Het
Pitx2 C T 3: 129,218,743 P254L probably damaging Het
Rdh10 T C 1: 16,106,184 F56S probably damaging Het
Rin1 T C 19: 5,054,886 L647P probably damaging Het
Sgk3 T A 1: 9,886,144 probably null Het
Sgpp1 A G 12: 75,716,294 I371T probably benign Het
Slc12a9 T C 5: 137,315,081 Y872C possibly damaging Het
Syne1 A G 10: 5,102,406 F7487L probably damaging Het
Tars T C 15: 11,389,699 N375S probably benign Het
Tbc1d31 A G 15: 57,938,029 Y320C probably damaging Het
Tbl1xr1 T A 3: 22,189,782 F73L probably benign Het
Tmem145 G A 7: 25,311,376 V378I probably benign Het
Tmprss11d T C 5: 86,309,350 H150R probably benign Het
Tnc T G 4: 63,995,598 I1326L probably benign Het
Trpc7 T C 13: 56,804,687 Y502C probably damaging Het
Usp32 T C 11: 85,025,686 I811V probably benign Het
Vmn1r71 C T 7: 10,748,216 A182T probably benign Het
Wdr47 T A 3: 108,633,096 N602K probably benign Het
Other mutations in Aoc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01900:Aoc2 APN 11 101328823 missense probably damaging 1.00
IGL02340:Aoc2 APN 11 101326375 missense probably damaging 1.00
IGL02382:Aoc2 APN 11 101326672 missense probably damaging 1.00
R0063:Aoc2 UTSW 11 101326071 missense probably damaging 1.00
R0063:Aoc2 UTSW 11 101326071 missense probably damaging 1.00
R0398:Aoc2 UTSW 11 101325553 missense possibly damaging 0.56
R1430:Aoc2 UTSW 11 101326495 missense probably damaging 1.00
R1681:Aoc2 UTSW 11 101325192 missense probably benign
R3157:Aoc2 UTSW 11 101329276 missense probably damaging 1.00
R3158:Aoc2 UTSW 11 101329276 missense probably damaging 1.00
R4159:Aoc2 UTSW 11 101325296 missense probably damaging 0.98
R4747:Aoc2 UTSW 11 101328820 critical splice acceptor site probably null
R5120:Aoc2 UTSW 11 101325714 missense probably benign 0.00
R5902:Aoc2 UTSW 11 101329246 missense probably damaging 1.00
R6032:Aoc2 UTSW 11 101325801 missense probably damaging 1.00
R6032:Aoc2 UTSW 11 101325801 missense probably damaging 1.00
R6317:Aoc2 UTSW 11 101325466 missense probably damaging 1.00
R7323:Aoc2 UTSW 11 101328545 missense probably damaging 1.00
R7491:Aoc2 UTSW 11 101328377 missense probably benign 0.14
R7584:Aoc2 UTSW 11 101326179 missense possibly damaging 0.50
Z1176:Aoc2 UTSW 11 101326420 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGGTCTATGTCCTGCTGACCAG -3'
(R):5'- CACAGTCACATCCCGCATGTAG -3'

Sequencing Primer
(F):5'- TGACCAGGCAAGGCAGTTTC -3'
(R):5'- ACATCCCGCATGTAGGAGGG -3'
Posted On2018-08-29