Incidental Mutation 'R6778:Sgpp1'
ID531384
Institutional Source Beutler Lab
Gene Symbol Sgpp1
Ensembl Gene ENSMUSG00000021054
Gene Namesphingosine-1-phosphate phosphatase 1
SynonymsSPP1, mSPP1, SPP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R6778 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location75714249-75735729 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75716294 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 371 (I371T)
Ref Sequence ENSEMBL: ENSMUSP00000021450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021450] [ENSMUST00000220285]
Predicted Effect probably benign
Transcript: ENSMUST00000021450
AA Change: I371T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000021450
Gene: ENSMUSG00000021054
AA Change: I371T

DomainStartEndE-ValueType
low complexity region 47 63 N/A INTRINSIC
acidPPc 150 264 1.5e-8 SMART
transmembrane domain 279 298 N/A INTRINSIC
transmembrane domain 346 368 N/A INTRINSIC
transmembrane domain 407 429 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220285
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sphingosine-1-phosphate (S1P) is a bioactive sphingolipid metabolite that regulates diverse biologic processes. SGPP1 catalyzes the degradation of S1P via salvage and recycling of sphingosine into long-chain ceramides (Mandala et al., 2000 [PubMed 10859351]; Le Stunff et al., 2007 [PubMed 17895250]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal keratinocyte differentiation and epidermal homeostasis with postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts14 T A 10: 61,225,452 N403Y probably damaging Het
Akap6 A G 12: 53,025,816 E989G probably damaging Het
Aoc2 A G 11: 101,325,361 N90S probably damaging Het
Apol9a T C 15: 77,404,333 Y278C probably benign Het
Casq2 T A 3: 102,127,931 probably null Het
Ccdc7a T A 8: 128,821,120 T1284S possibly damaging Het
Dlat A G 9: 50,650,857 L289P probably damaging Het
Dnah8 C T 17: 30,635,666 P101S probably benign Het
Dzip3 C A 16: 48,982,083 A28S probably benign Het
Fam205c T C 4: 42,868,522 K367R possibly damaging Het
Ffar4 A G 19: 38,113,664 E249G possibly damaging Het
Fubp3 A T 2: 31,598,673 K180N possibly damaging Het
Gm7489 T A 15: 53,885,952 probably benign Het
Ifitm6 A T 7: 141,016,143 M59K possibly damaging Het
Igkv4-80 A T 6: 69,016,561 Y115* probably null Het
Igsf21 G T 4: 140,034,648 R240S probably benign Het
Kank4 A T 4: 98,761,505 N942K probably benign Het
Man2a1 C A 17: 64,714,635 T35K possibly damaging Het
Mvk T A 5: 114,452,380 D193E probably benign Het
Npas2 T A 1: 39,325,300 M241K possibly damaging Het
Npsr1 T A 9: 24,254,618 I100N possibly damaging Het
Olfml2b A G 1: 170,645,070 D50G probably damaging Het
Olfr961 T A 9: 39,646,747 V7E probably damaging Het
Pcnx A G 12: 81,918,871 D604G probably damaging Het
Pitx2 C T 3: 129,218,743 P254L probably damaging Het
Rdh10 T C 1: 16,106,184 F56S probably damaging Het
Rin1 T C 19: 5,054,886 L647P probably damaging Het
Sgk3 T A 1: 9,886,144 probably null Het
Slc12a9 T C 5: 137,315,081 Y872C possibly damaging Het
Syne1 A G 10: 5,102,406 F7487L probably damaging Het
Tars T C 15: 11,389,699 N375S probably benign Het
Tbc1d31 A G 15: 57,938,029 Y320C probably damaging Het
Tbl1xr1 T A 3: 22,189,782 F73L probably benign Het
Tmem145 G A 7: 25,311,376 V378I probably benign Het
Tmprss11d T C 5: 86,309,350 H150R probably benign Het
Tnc T G 4: 63,995,598 I1326L probably benign Het
Trpc7 T C 13: 56,804,687 Y502C probably damaging Het
Usp32 T C 11: 85,025,686 I811V probably benign Het
Vmn1r71 C T 7: 10,748,216 A182T probably benign Het
Wdr47 T A 3: 108,633,096 N602K probably benign Het
Other mutations in Sgpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Sgpp1 APN 12 75716194 nonsense probably null
IGL01348:Sgpp1 APN 12 75734993 missense probably damaging 1.00
IGL01481:Sgpp1 APN 12 75722657 missense probably benign 0.31
IGL03384:Sgpp1 APN 12 75716106 unclassified probably benign
R0597:Sgpp1 UTSW 12 75735100 missense probably damaging 1.00
R1203:Sgpp1 UTSW 12 75716282 missense probably benign 0.07
R1648:Sgpp1 UTSW 12 75716216 missense possibly damaging 0.94
R1842:Sgpp1 UTSW 12 75716208 missense probably damaging 1.00
R1932:Sgpp1 UTSW 12 75716179 nonsense probably null
R1958:Sgpp1 UTSW 12 75735448 missense probably benign 0.00
R2098:Sgpp1 UTSW 12 75716510 missense probably damaging 1.00
R4034:Sgpp1 UTSW 12 75716190 missense probably damaging 1.00
R4730:Sgpp1 UTSW 12 75734939 missense probably benign
R5531:Sgpp1 UTSW 12 75735207 nonsense probably null
R6733:Sgpp1 UTSW 12 75735469 missense probably benign 0.22
R6775:Sgpp1 UTSW 12 75735469 missense probably benign 0.22
R6783:Sgpp1 UTSW 12 75735469 missense probably benign 0.22
R6784:Sgpp1 UTSW 12 75735469 missense probably benign 0.22
R6928:Sgpp1 UTSW 12 75716570 missense probably damaging 1.00
R7381:Sgpp1 UTSW 12 75716264 missense probably damaging 1.00
R7805:Sgpp1 UTSW 12 75722677 missense probably damaging 0.97
R8113:Sgpp1 UTSW 12 75716600 missense probably damaging 0.97
RF043:Sgpp1 UTSW 12 75722625 frame shift probably null
X0018:Sgpp1 UTSW 12 75716518 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGGTAGCCTCCTTTCTTATAAC -3'
(R):5'- ACGGCTGAGATTCTGGGAAG -3'

Sequencing Primer
(F):5'- GTGTTCCTCCATCAAGAGATACC -3'
(R):5'- CTGAGATTCTGGGAAGTGGTGC -3'
Posted On2018-08-29