Mutagenetix > Incidental Mutations

Incidental Mutation 'R6778:Pcnx'

531385

Institutional Source

Beutler Lab

Gene Symbol

Pcnx

Ensembl Gene

ENSMUSG00000021140

Gene Name

pecanex homolog

Synonyms

3526401J03Rik, 2900024E21Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6778 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

81860023-82000924 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 81918871 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 604 (D604G)

Ref Sequence

ENSEMBL: ENSMUSP00000152302 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021567] [ENSMUST00000221721] [ENSMUST00000222005]

Predicted Effect

probably damaging
Transcript: ENSMUST00000021567
AA Change: D604G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000021567
Gene: ENSMUSG00000021140
AA Change: D604G

Domain	Start	End	E-Value	Type
transmembrane domain	28	50	N/A	INTRINSIC
transmembrane domain	52	74	N/A	INTRINSIC
low complexity region	369	390	N/A	INTRINSIC
low complexity region	407	422	N/A	INTRINSIC
low complexity region	509	525	N/A	INTRINSIC
low complexity region	616	638	N/A	INTRINSIC
low complexity region	672	692	N/A	INTRINSIC
low complexity region	764	783	N/A	INTRINSIC
low complexity region	817	835	N/A	INTRINSIC
low complexity region	842	853	N/A	INTRINSIC
low complexity region	911	922	N/A	INTRINSIC
transmembrane domain	1006	1028	N/A	INTRINSIC
transmembrane domain	1035	1052	N/A	INTRINSIC
transmembrane domain	1070	1092	N/A	INTRINSIC
transmembrane domain	1113	1135	N/A	INTRINSIC
transmembrane domain	1163	1185	N/A	INTRINSIC
transmembrane domain	1197	1216	N/A	INTRINSIC
transmembrane domain	1269	1291	N/A	INTRINSIC
transmembrane domain	1298	1315	N/A	INTRINSIC
Pfam:Pecanex_C	1785	2011	1.6e-118	PFAM
low complexity region	2125	2140	N/A	INTRINSIC
low complexity region	2195	2202	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000221675
AA Change: D76G

Predicted Effect

possibly damaging
Transcript: ENSMUST00000221721
AA Change: D604G

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

probably damaging
Transcript: ENSMUST00000222005
AA Change: D604G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an evolutionarily conserved transmembrane protein similar to the pecanex protein in Drosophila. The fly protein is a component of the Notch signaling pathway, which functions in several developmental processes. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts14	T	A	10: 61,225,452	N403Y	probably damaging	Het
Akap6	A	G	12: 53,025,816	E989G	probably damaging	Het
Aoc2	A	G	11: 101,325,361	N90S	probably damaging	Het
Apol9a	T	C	15: 77,404,333	Y278C	probably benign	Het
Casq2	T	A	3: 102,127,931		probably null	Het
Ccdc7a	T	A	8: 128,821,120	T1284S	possibly damaging	Het
Dlat	A	G	9: 50,650,857	L289P	probably damaging	Het
Dnah8	C	T	17: 30,635,666	P101S	probably benign	Het
Dzip3	C	A	16: 48,982,083	A28S	probably benign	Het
Fam205c	T	C	4: 42,868,522	K367R	possibly damaging	Het
Ffar4	A	G	19: 38,113,664	E249G	possibly damaging	Het
Fubp3	A	T	2: 31,598,673	K180N	possibly damaging	Het
Gm7489	T	A	15: 53,885,952		probably benign	Het
Ifitm6	A	T	7: 141,016,143	M59K	possibly damaging	Het
Igkv4-80	A	T	6: 69,016,561	Y115*	probably null	Het
Igsf21	G	T	4: 140,034,648	R240S	probably benign	Het
Kank4	A	T	4: 98,761,505	N942K	probably benign	Het
Man2a1	C	A	17: 64,714,635	T35K	possibly damaging	Het
Mvk	T	A	5: 114,452,380	D193E	probably benign	Het
Npas2	T	A	1: 39,325,300	M241K	possibly damaging	Het
Npsr1	T	A	9: 24,254,618	I100N	possibly damaging	Het
Olfml2b	A	G	1: 170,645,070	D50G	probably damaging	Het
Olfr961	T	A	9: 39,646,747	V7E	probably damaging	Het
Pitx2	C	T	3: 129,218,743	P254L	probably damaging	Het
Rdh10	T	C	1: 16,106,184	F56S	probably damaging	Het
Rin1	T	C	19: 5,054,886	L647P	probably damaging	Het
Sgk3	T	A	1: 9,886,144		probably null	Het
Sgpp1	A	G	12: 75,716,294	I371T	probably benign	Het
Slc12a9	T	C	5: 137,315,081	Y872C	possibly damaging	Het
Syne1	A	G	10: 5,102,406	F7487L	probably damaging	Het
Tars	T	C	15: 11,389,699	N375S	probably benign	Het
Tbc1d31	A	G	15: 57,938,029	Y320C	probably damaging	Het
Tbl1xr1	T	A	3: 22,189,782	F73L	probably benign	Het
Tmem145	G	A	7: 25,311,376	V378I	probably benign	Het
Tmprss11d	T	C	5: 86,309,350	H150R	probably benign	Het
Tnc	T	G	4: 63,995,598	I1326L	probably benign	Het
Trpc7	T	C	13: 56,804,687	Y502C	probably damaging	Het
Usp32	T	C	11: 85,025,686	I811V	probably benign	Het
Vmn1r71	C	T	7: 10,748,216	A182T	probably benign	Het
Wdr47	T	A	3: 108,633,096	N602K	probably benign	Het

Other mutations in Pcnx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Pcnx	APN	12	81895101	missense	probably damaging	0.98
IGL00561:Pcnx	APN	12	81996053	missense	probably damaging	1.00
IGL01066:Pcnx	APN	12	81992021	missense	possibly damaging	0.87
IGL01069:Pcnx	APN	12	81918144	missense	probably benign	0.27
IGL01082:Pcnx	APN	12	81990598	missense	possibly damaging	0.62
IGL01087:Pcnx	APN	12	81995339	splice site	probably benign
IGL01145:Pcnx	APN	12	81992035	missense	probably damaging	0.99
IGL01412:Pcnx	APN	12	81906465	missense	probably damaging	1.00
IGL01477:Pcnx	APN	12	81973241	missense	probably damaging	0.98
IGL01639:Pcnx	APN	12	81950320	critical splice donor site	probably null
IGL01815:Pcnx	APN	12	81990551	missense	probably damaging	1.00
IGL01870:Pcnx	APN	12	81975893	missense	probably benign	0.01
IGL01902:Pcnx	APN	12	81979094	missense	probably damaging	1.00
IGL01935:Pcnx	APN	12	81917816	missense	probably benign	0.00
IGL02141:Pcnx	APN	12	81860382	missense	possibly damaging	0.86
IGL02179:Pcnx	APN	12	81933719	intron	probably benign
IGL02197:Pcnx	APN	12	81919104	missense	probably benign	0.01
IGL02197:Pcnx	APN	12	81993151	missense	possibly damaging	0.85
IGL02238:Pcnx	APN	12	81917914	missense	probably damaging	1.00
IGL02430:Pcnx	APN	12	81919322	missense	possibly damaging	0.89
IGL02590:Pcnx	APN	12	81994978	missense	probably damaging	1.00
IGL02992:Pcnx	APN	12	81964120	missense	probably damaging	1.00
IGL03304:Pcnx	APN	12	81982029	missense	probably damaging	1.00
PIT4515001:Pcnx	UTSW	12	81991787	missense
R0086:Pcnx	UTSW	12	81992058	unclassified	probably benign
R0114:Pcnx	UTSW	12	81996095	missense	possibly damaging	0.95
R0240:Pcnx	UTSW	12	81947018	missense	possibly damaging	0.67
R0240:Pcnx	UTSW	12	81947018	missense	possibly damaging	0.67
R0376:Pcnx	UTSW	12	81974579	splice site	probably benign
R0377:Pcnx	UTSW	12	81974579	splice site	probably benign
R0416:Pcnx	UTSW	12	81974466	missense	probably benign	0.09
R0514:Pcnx	UTSW	12	81995110	missense	probably benign	0.21
R0563:Pcnx	UTSW	12	81917944	missense	probably damaging	1.00
R0569:Pcnx	UTSW	12	81992030	missense	probably benign	0.08
R0626:Pcnx	UTSW	12	81983676	missense	possibly damaging	0.82
R0972:Pcnx	UTSW	12	81913412	missense	probably damaging	1.00
R1205:Pcnx	UTSW	12	81956243	missense	probably damaging	1.00
R1455:Pcnx	UTSW	12	81973234	missense	probably damaging	1.00
R1514:Pcnx	UTSW	12	81918798	missense	probably damaging	1.00
R1731:Pcnx	UTSW	12	81990704	missense	probably damaging	1.00
R1758:Pcnx	UTSW	12	81983484	missense	probably benign	0.27
R1774:Pcnx	UTSW	12	81975320	missense	probably damaging	1.00
R1817:Pcnx	UTSW	12	81918642	missense	probably benign
R1843:Pcnx	UTSW	12	81980935	missense	probably damaging	1.00
R1862:Pcnx	UTSW	12	81918732	missense	probably damaging	1.00
R2042:Pcnx	UTSW	12	81918293	missense	probably damaging	1.00
R2054:Pcnx	UTSW	12	81933674	missense	probably benign	0.02
R2243:Pcnx	UTSW	12	81918705	missense	probably damaging	1.00
R2272:Pcnx	UTSW	12	81995314	missense	probably benign	0.26
R2360:Pcnx	UTSW	12	81950186	missense	probably damaging	0.99
R2926:Pcnx	UTSW	12	81994995	missense	probably damaging	1.00
R3607:Pcnx	UTSW	12	81928292	missense	probably damaging	1.00
R3781:Pcnx	UTSW	12	81996118	missense	probably benign	0.00
R3782:Pcnx	UTSW	12	81996118	missense	probably benign	0.00
R3806:Pcnx	UTSW	12	81950137	missense	possibly damaging	0.84
R3926:Pcnx	UTSW	12	81958731	missense	probably damaging	1.00
R4019:Pcnx	UTSW	12	81918244	missense	probably damaging	1.00
R4020:Pcnx	UTSW	12	81918244	missense	probably damaging	1.00
R4683:Pcnx	UTSW	12	81986672	missense	probably benign	0.01
R4703:Pcnx	UTSW	12	81895164	missense	probably benign	0.01
R4732:Pcnx	UTSW	12	81995751	missense	probably benign	0.01
R4733:Pcnx	UTSW	12	81995751	missense	probably benign	0.01
R4755:Pcnx	UTSW	12	81950294	missense	probably damaging	1.00
R4792:Pcnx	UTSW	12	81919151	missense	probably damaging	1.00
R4897:Pcnx	UTSW	12	81918165	missense	probably damaging	1.00
R4915:Pcnx	UTSW	12	81974495	missense	probably benign	0.10
R4934:Pcnx	UTSW	12	81991825	missense	possibly damaging	0.76
R4940:Pcnx	UTSW	12	81917793	missense	possibly damaging	0.60
R5079:Pcnx	UTSW	12	81979089	nonsense	probably null
R5087:Pcnx	UTSW	12	81994939	missense	probably damaging	1.00
R5284:Pcnx	UTSW	12	81919029	missense	probably benign	0.02
R5287:Pcnx	UTSW	12	81982051	missense	probably damaging	1.00
R5436:Pcnx	UTSW	12	81860406	missense	probably damaging	1.00
R5505:Pcnx	UTSW	12	81950153	missense	probably damaging	1.00
R5538:Pcnx	UTSW	12	81860409	missense	probably damaging	1.00
R5632:Pcnx	UTSW	12	81917730	missense	probably damaging	1.00
R5642:Pcnx	UTSW	12	81895029	missense	possibly damaging	0.45
R5841:Pcnx	UTSW	12	81918655	missense	possibly damaging	0.62
R6275:Pcnx	UTSW	12	81918607	missense	probably benign	0.34
R6508:Pcnx	UTSW	12	81912705	missense	probably damaging	0.98
R6532:Pcnx	UTSW	12	81980964	missense	probably damaging	1.00
R6634:Pcnx	UTSW	12	81917882	nonsense	probably null
R6753:Pcnx	UTSW	12	81964480	missense	probably damaging	1.00
R6776:Pcnx	UTSW	12	81962722	missense	possibly damaging	0.81
R6890:Pcnx	UTSW	12	81971376	missense	probably benign	0.09
R6894:Pcnx	UTSW	12	81987973	missense	probably damaging	1.00
R6927:Pcnx	UTSW	12	81917812	missense	probably benign	0.37
R7173:Pcnx	UTSW	12	81953003	splice site	probably null
R7196:Pcnx	UTSW	12	81995538	missense	possibly damaging	0.94
R7316:Pcnx	UTSW	12	81995549	missense	probably benign	0.16
R7559:Pcnx	UTSW	12	81993122	missense	unknown
R7635:Pcnx	UTSW	12	81919125	missense
R7669:Pcnx	UTSW	12	81990551	missense	probably damaging	1.00
R8021:Pcnx	UTSW	12	81918819	nonsense	probably null
R8049:Pcnx	UTSW	12	81918819	nonsense	probably null
R8078:Pcnx	UTSW	12	81975280	missense
R8093:Pcnx	UTSW	12	81918819	nonsense	probably null
R8104:Pcnx	UTSW	12	81983611	nonsense	probably null
R8108:Pcnx	UTSW	12	81918819	nonsense	probably null
R8109:Pcnx	UTSW	12	81918819	nonsense	probably null
R8131:Pcnx	UTSW	12	81918518	missense	possibly damaging	0.80
R8136:Pcnx	UTSW	12	81918006	missense	probably benign
R8153:Pcnx	UTSW	12	81918819	nonsense	probably null
R8156:Pcnx	UTSW	12	81918819	nonsense	probably null
R8202:Pcnx	UTSW	12	81895047	missense	probably benign	0.00
R8362:Pcnx	UTSW	12	81967056	missense
R8515:Pcnx	UTSW	12	81962716	missense	possibly damaging	0.83
RF024:Pcnx	UTSW	12	81917727	missense	probably damaging	0.98
Z1177:Pcnx	UTSW	12	81918202	missense	probably damaging	0.98
Z1177:Pcnx	UTSW	12	81918677	missense

Predicted Primers

PCR Primer
(F):5'- CGACTCCAGAGTTTGTAAAGACG -3'
(R):5'- ACTTGTGCTGGAAGTCCTCC -3'

Sequencing Primer
(F):5'- CTCCAGAGTTTGTAAAGACGATGGTG -3'
(R):5'- CCTGGATGAGCTCTGTGC -3'

Posted On

2018-08-29