Incidental Mutation 'R6778:Gm7489'
ID531388
Institutional Source Beutler Lab
Gene Symbol Gm7489
Ensembl Gene ENSMUSG00000072584
Gene Namepredicted gene 7489
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R6778 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location53884906-53886597 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 53885952 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078673] [ENSMUST00000100666] [ENSMUST00000132059]
Predicted Effect probably benign
Transcript: ENSMUST00000078673
SMART Domains Protein: ENSMUSP00000077741
Gene: ENSMUSG00000058656

DomainStartEndE-ValueType
SAM 74 143 1e-8 SMART
Predicted Effect unknown
Transcript: ENSMUST00000100666
AA Change: I140K
Predicted Effect probably benign
Transcript: ENSMUST00000132059
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts14 T A 10: 61,225,452 N403Y probably damaging Het
Akap6 A G 12: 53,025,816 E989G probably damaging Het
Aoc2 A G 11: 101,325,361 N90S probably damaging Het
Apol9a T C 15: 77,404,333 Y278C probably benign Het
Casq2 T A 3: 102,127,931 probably null Het
Ccdc7a T A 8: 128,821,120 T1284S possibly damaging Het
Dlat A G 9: 50,650,857 L289P probably damaging Het
Dnah8 C T 17: 30,635,666 P101S probably benign Het
Dzip3 C A 16: 48,982,083 A28S probably benign Het
Fam205c T C 4: 42,868,522 K367R possibly damaging Het
Ffar4 A G 19: 38,113,664 E249G possibly damaging Het
Fubp3 A T 2: 31,598,673 K180N possibly damaging Het
Ifitm6 A T 7: 141,016,143 M59K possibly damaging Het
Igkv4-80 A T 6: 69,016,561 Y115* probably null Het
Igsf21 G T 4: 140,034,648 R240S probably benign Het
Kank4 A T 4: 98,761,505 N942K probably benign Het
Man2a1 C A 17: 64,714,635 T35K possibly damaging Het
Mvk T A 5: 114,452,380 D193E probably benign Het
Npas2 T A 1: 39,325,300 M241K possibly damaging Het
Npsr1 T A 9: 24,254,618 I100N possibly damaging Het
Olfml2b A G 1: 170,645,070 D50G probably damaging Het
Olfr961 T A 9: 39,646,747 V7E probably damaging Het
Pcnx A G 12: 81,918,871 D604G probably damaging Het
Pitx2 C T 3: 129,218,743 P254L probably damaging Het
Rdh10 T C 1: 16,106,184 F56S probably damaging Het
Rin1 T C 19: 5,054,886 L647P probably damaging Het
Sgk3 T A 1: 9,886,144 probably null Het
Sgpp1 A G 12: 75,716,294 I371T probably benign Het
Slc12a9 T C 5: 137,315,081 Y872C possibly damaging Het
Syne1 A G 10: 5,102,406 F7487L probably damaging Het
Tars T C 15: 11,389,699 N375S probably benign Het
Tbc1d31 A G 15: 57,938,029 Y320C probably damaging Het
Tbl1xr1 T A 3: 22,189,782 F73L probably benign Het
Tmem145 G A 7: 25,311,376 V378I probably benign Het
Tmprss11d T C 5: 86,309,350 H150R probably benign Het
Tnc T G 4: 63,995,598 I1326L probably benign Het
Trpc7 T C 13: 56,804,687 Y502C probably damaging Het
Usp32 T C 11: 85,025,686 I811V probably benign Het
Vmn1r71 C T 7: 10,748,216 A182T probably benign Het
Wdr47 T A 3: 108,633,096 N602K probably benign Het
Other mutations in Gm7489
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4458001:Gm7489 UTSW 15 53885799 missense unknown
R2319:Gm7489 UTSW 15 53885049 intron probably benign
R4852:Gm7489 UTSW 15 53886038 intron probably benign
R5212:Gm7489 UTSW 15 53885620 intron probably benign
R7832:Gm7489 UTSW 15 53886006 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTATTAGTGCACTGTTGGGTAGAAG -3'
(R):5'- TTGATGAAAGTGGGCATGCC -3'

Sequencing Primer
(F):5'- CACTGTTGGGTAGAAGCAGGC -3'
(R):5'- GTGGGCATGCCAATAATACATTC -3'
Posted On2018-08-29