Incidental Mutation 'R6778:Ffar4'
ID531395
Institutional Source Beutler Lab
Gene Symbol Ffar4
Ensembl Gene ENSMUSG00000054200
Gene Namefree fatty acid receptor 4
SynonymsGpr129, O3far1, Pgr4, Gpr120
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R6778 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location38097079-38114263 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38113664 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 249 (E249G)
Ref Sequence ENSEMBL: ENSMUSP00000063660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025951] [ENSMUST00000067098] [ENSMUST00000112335]
Predicted Effect probably benign
Transcript: ENSMUST00000025951
SMART Domains Protein: ENSMUSP00000025951
Gene: ENSMUSG00000024990

DomainStartEndE-ValueType
low complexity region 47 60 N/A INTRINSIC
Pfam:Lipocalin_2 77 229 8.2e-9 PFAM
Pfam:Lipocalin 83 229 8.3e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000067098
AA Change: E249G

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000063660
Gene: ENSMUSG00000054200
AA Change: E249G

DomainStartEndE-ValueType
Pfam:7tm_1 57 321 1.7e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112335
SMART Domains Protein: ENSMUSP00000107954
Gene: ENSMUSG00000024990

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Lipocalin_2 33 186 3.6e-9 PFAM
Pfam:Lipocalin 39 185 6.5e-21 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-coupled receptor (GPR) which belongs to the rhodopsin family of GPRs. The encoded protein functions as a receptor for free fatty acids, including omega-3, and participates in suppressing anti-inflammatory responses and insulin sensitizing. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygotes for a null allele show altered taste responses to fatty acids. Homozygotes for another null allele develop obesity, liver steatosis, and impaired glucose metabolism, adipogenesis and lipogenesis on a high-fat diet. Homozygotes for a third allele show altered islet somatostatin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts14 T A 10: 61,225,452 N403Y probably damaging Het
Akap6 A G 12: 53,025,816 E989G probably damaging Het
Aoc2 A G 11: 101,325,361 N90S probably damaging Het
Apol9a T C 15: 77,404,333 Y278C probably benign Het
Casq2 T A 3: 102,127,931 probably null Het
Ccdc7a T A 8: 128,821,120 T1284S possibly damaging Het
Dlat A G 9: 50,650,857 L289P probably damaging Het
Dnah8 C T 17: 30,635,666 P101S probably benign Het
Dzip3 C A 16: 48,982,083 A28S probably benign Het
Fam205c T C 4: 42,868,522 K367R possibly damaging Het
Fubp3 A T 2: 31,598,673 K180N possibly damaging Het
Gm7489 T A 15: 53,885,952 probably benign Het
Ifitm6 A T 7: 141,016,143 M59K possibly damaging Het
Igkv4-80 A T 6: 69,016,561 Y115* probably null Het
Igsf21 G T 4: 140,034,648 R240S probably benign Het
Kank4 A T 4: 98,761,505 N942K probably benign Het
Man2a1 C A 17: 64,714,635 T35K possibly damaging Het
Mvk T A 5: 114,452,380 D193E probably benign Het
Npas2 T A 1: 39,325,300 M241K possibly damaging Het
Npsr1 T A 9: 24,254,618 I100N possibly damaging Het
Olfml2b A G 1: 170,645,070 D50G probably damaging Het
Olfr961 T A 9: 39,646,747 V7E probably damaging Het
Pcnx A G 12: 81,918,871 D604G probably damaging Het
Pitx2 C T 3: 129,218,743 P254L probably damaging Het
Rdh10 T C 1: 16,106,184 F56S probably damaging Het
Rin1 T C 19: 5,054,886 L647P probably damaging Het
Sgk3 T A 1: 9,886,144 probably null Het
Sgpp1 A G 12: 75,716,294 I371T probably benign Het
Slc12a9 T C 5: 137,315,081 Y872C possibly damaging Het
Syne1 A G 10: 5,102,406 F7487L probably damaging Het
Tars T C 15: 11,389,699 N375S probably benign Het
Tbc1d31 A G 15: 57,938,029 Y320C probably damaging Het
Tbl1xr1 T A 3: 22,189,782 F73L probably benign Het
Tmem145 G A 7: 25,311,376 V378I probably benign Het
Tmprss11d T C 5: 86,309,350 H150R probably benign Het
Tnc T G 4: 63,995,598 I1326L probably benign Het
Trpc7 T C 13: 56,804,687 Y502C probably damaging Het
Usp32 T C 11: 85,025,686 I811V probably benign Het
Vmn1r71 C T 7: 10,748,216 A182T probably benign Het
Wdr47 T A 3: 108,633,096 N602K probably benign Het
Other mutations in Ffar4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Ffar4 APN 19 38107389 missense probably benign
IGL01734:Ffar4 APN 19 38113847 missense probably damaging 1.00
IGL01932:Ffar4 APN 19 38097530 missense probably damaging 1.00
IGL02160:Ffar4 APN 19 38097455 missense possibly damaging 0.91
IGL02486:Ffar4 APN 19 38113760 missense possibly damaging 0.68
R0047:Ffar4 UTSW 19 38114004 unclassified probably benign
R0492:Ffar4 UTSW 19 38097182 missense probably benign
R4956:Ffar4 UTSW 19 38097580 missense probably benign 0.01
R5091:Ffar4 UTSW 19 38097179 missense probably benign
R5634:Ffar4 UTSW 19 38113925 unclassified probably benign
R5756:Ffar4 UTSW 19 38113958 missense probably damaging 0.99
R8030:Ffar4 UTSW 19 38107391 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GGCTGCAATTCTCAGTACCAC -3'
(R):5'- AGTTGGCAAACGTGAAGGCC -3'

Sequencing Primer
(F):5'- TGGCCTTGCACTCACAGAGATC -3'
(R):5'- GTGAAGGCCACCACCCAG -3'
Posted On2018-08-29