Incidental Mutation 'R6781:Yod1'
ID531398
Institutional Source Beutler Lab
Gene Symbol Yod1
Ensembl Gene ENSMUSG00000046404
Gene NameYOD1 deubiquitinase
Synonyms9930028C20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6781 (G1)
Quality Score161.009
Status Validated
Chromosome1
Chromosomal Location130717327-130724358 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 130717538 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 19 (G19S)
Ref Sequence ENSEMBL: ENSMUSP00000055318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049813] [ENSMUST00000050406] [ENSMUST00000066863] [ENSMUST00000169659] [ENSMUST00000171479] [ENSMUST00000185233] [ENSMUST00000186777] [ENSMUST00000186867] [ENSMUST00000187089] [ENSMUST00000188520] [ENSMUST00000189167] [ENSMUST00000189534] [ENSMUST00000191301] [ENSMUST00000191347]
PDB Structure
Solution NMR Structure of Ubiquitin thioesterase OTU1 (EC 3.1.2.-) from Mus musculus, Northeast Structural Genomics Consortium Target MmT2A [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000049813
AA Change: G19S

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000055318
Gene: ENSMUSG00000046404
AA Change: G19S

DomainStartEndE-ValueType
PDB:2KZR|A 42 127 3e-54 PDB
Blast:UBQ 43 118 2e-20 BLAST
Pfam:OTU 150 268 3.4e-8 PFAM
ZnF_C2H2 313 337 2.12e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000050406
SMART Domains Protein: ENSMUSP00000133073
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 8.1e-107 PFAM
Pfam:KTI12 40 206 9.6e-8 PFAM
Pfam:AAA_33 42 198 3.1e-9 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066863
SMART Domains Protein: ENSMUSP00000066426
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-106 PFAM
Pfam:KTI12 41 207 3.5e-8 PFAM
Pfam:AAA_33 42 199 1.2e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169659
SMART Domains Protein: ENSMUSP00000127587
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.3e-106 PFAM
Pfam:KTI12 41 207 4.3e-8 PFAM
Pfam:AAA_33 42 199 1.2e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171479
SMART Domains Protein: ENSMUSP00000129747
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-106 PFAM
Pfam:KTI12 41 208 3.7e-8 PFAM
Pfam:AAA_33 42 199 1.1e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185233
SMART Domains Protein: ENSMUSP00000140551
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-106 PFAM
Pfam:KTI12 41 207 3.5e-8 PFAM
Pfam:AAA_33 42 199 1.2e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186777
Predicted Effect probably benign
Transcript: ENSMUST00000186867
Predicted Effect probably benign
Transcript: ENSMUST00000187089
SMART Domains Protein: ENSMUSP00000140612
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1e-103 PFAM
Pfam:KTI12 41 207 2.3e-5 PFAM
Pfam:AAA_33 42 199 1.4e-8 PFAM
PGAM 253 400 2.9e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188520
SMART Domains Protein: ENSMUSP00000140786
Gene: ENSMUSG00000101904

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 6.3e-107 PFAM
Pfam:KTI12 41 209 2.3e-8 PFAM
Pfam:AAA_33 42 199 6.4e-11 PFAM
PGAM 253 342 1.31e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189167
SMART Domains Protein: ENSMUSP00000140984
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 6.3e-107 PFAM
Pfam:KTI12 41 209 2.3e-8 PFAM
Pfam:AAA_33 42 199 6.4e-11 PFAM
PGAM 253 342 1.31e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189534
SMART Domains Protein: ENSMUSP00000140355
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-106 PFAM
Pfam:KTI12 41 208 3.7e-8 PFAM
Pfam:AAA_33 42 199 1.1e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191301
SMART Domains Protein: ENSMUSP00000140995
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 181 9.5e-70 PFAM
Pfam:KTI12 41 183 3.2e-8 PFAM
Pfam:AAA_33 42 184 1.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191347
SMART Domains Protein: ENSMUSP00000140698
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-103 PFAM
Pfam:KTI12 41 207 2.4e-5 PFAM
Pfam:AAA_33 42 199 1.6e-8 PFAM
PGAM 253 400 2.9e-20 SMART
Meta Mutation Damage Score 0.0977 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein ubiquitination controls many intracellular processes, including cell cycle progression, transcriptional activation, and signal transduction. This dynamic process, involving ubiquitin conjugating enzymes and deubiquitinating enzymes, adds and removes ubiquitin. Deubiquitinating enzymes are cysteine proteases that specifically cleave ubiquitin from ubiquitin-conjugated protein substrates. The protein encoded by this gene belongs to a DUB subfamily characterized by an ovarian tumor (OTU) domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,374,406 I259N possibly damaging Het
Acot12 G T 13: 91,784,412 probably null Het
AI182371 G T 2: 35,084,705 probably benign Het
Amigo3 T C 9: 108,053,963 L195P probably damaging Het
Aox4 A T 1: 58,245,109 D556V probably benign Het
Arhgef40 A C 14: 51,997,897 probably benign Het
Asb15 T C 6: 24,558,675 V63A probably benign Het
Bicd1 T C 6: 149,513,166 I459T possibly damaging Het
Bub1 C A 2: 127,807,857 G694W probably damaging Het
C4b A T 17: 34,742,954 I106N probably damaging Het
Clca4b T C 3: 144,922,801 I382V probably benign Het
Cntnap5a A C 1: 116,292,397 S646R probably benign Het
Cntnap5c C T 17: 58,138,653 Q563* probably null Het
Cpn1 A G 19: 43,980,904 F107L possibly damaging Het
Csrnp3 T A 2: 66,022,271 C336S probably benign Het
Defa3 T A 8: 21,288,261 M87K probably benign Het
Dmbt1 T C 7: 131,046,561 F274L probably benign Het
Dnah8 TTA TTATA 17: 30,765,724 probably null Het
Dnase2b T C 3: 146,582,371 H323R probably benign Het
Fam83e A T 7: 45,722,147 probably benign Het
Fbn1 T C 2: 125,317,038 N2269S probably damaging Het
Foxa1 A T 12: 57,543,257 M59K possibly damaging Het
Fpr3 T C 17: 17,970,716 V83A probably benign Het
Frmd6 A G 12: 70,899,643 D615G possibly damaging Het
Gfra3 T C 18: 34,711,322 K55R possibly damaging Het
Gm5414 A T 15: 101,625,661 S296T possibly damaging Het
Gtf3c1 T A 7: 125,659,197 K1234* probably null Het
Hltf T A 3: 20,098,166 Y609N probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ift74 A G 4: 94,627,302 D152G probably damaging Het
Kcnk6 T C 7: 29,225,055 Y308C probably damaging Het
Klhl29 A G 12: 5,091,347 S546P probably damaging Het
Map7d1 AGGGCAGCC AGGGCAGCCGGGCAGCC 4: 126,240,751 probably null Het
Meis2 T A 2: 116,049,155 H228L probably benign Het
Mfsd10 A T 5: 34,634,509 M344K possibly damaging Het
Mrps33 T C 6: 39,805,823 probably benign Het
Olfr1198 A T 2: 88,746,830 N19K probably benign Het
Olfr437 A G 6: 43,167,388 E110G probably damaging Het
Pik3cb T C 9: 99,040,992 T996A possibly damaging Het
Plekha7 A G 7: 116,157,855 probably null Het
Ppp1cb A G 5: 32,480,762 Y86C probably damaging Het
Sass6 T G 3: 116,595,124 probably benign Het
Slc6a15 A T 10: 103,395,067 I218F probably damaging Het
St5 T C 7: 109,525,304 D1110G possibly damaging Het
Tcf23 C T 5: 30,968,960 P61L probably benign Het
Zc3h6 T C 2: 129,015,421 F620S probably damaging Het
Other mutations in Yod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Yod1 APN 1 130719133 missense probably damaging 1.00
IGL02321:Yod1 APN 1 130718951 missense probably damaging 1.00
IGL03018:Yod1 APN 1 130718958 missense probably benign 0.08
R1310:Yod1 UTSW 1 130718830 missense probably benign
R5825:Yod1 UTSW 1 130719006 missense probably damaging 1.00
R6115:Yod1 UTSW 1 130719063 missense possibly damaging 0.48
R6367:Yod1 UTSW 1 130717538 missense probably damaging 0.96
R6437:Yod1 UTSW 1 130719148 missense probably damaging 1.00
R6489:Yod1 UTSW 1 130717538 missense probably damaging 0.96
R6491:Yod1 UTSW 1 130717538 missense probably damaging 0.96
R6729:Yod1 UTSW 1 130717538 missense probably damaging 0.96
R6731:Yod1 UTSW 1 130717538 missense probably damaging 0.96
R6732:Yod1 UTSW 1 130717538 missense probably damaging 0.96
R6742:Yod1 UTSW 1 130717538 missense probably damaging 0.96
R6743:Yod1 UTSW 1 130717538 missense probably damaging 0.96
R6766:Yod1 UTSW 1 130719271 nonsense probably null
R7831:Yod1 UTSW 1 130719249 missense probably damaging 0.99
R7914:Yod1 UTSW 1 130719249 missense probably damaging 0.99
R8058:Yod1 UTSW 1 130719069 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCTGCTCTGCTAGACTCGG -3'
(R):5'- AGGTCCCCAAGAGTGATGTC -3'

Sequencing Primer
(F):5'- TCTGCTAGACTCGGGAACTC -3'
(R):5'- AAGAGTGATGTCCCGGTCG -3'
Posted On2018-08-29