Incidental Mutation 'R6781:Meis2'
ID531401
Institutional Source Beutler Lab
Gene Symbol Meis2
Ensembl Gene ENSMUSG00000027210
Gene NameMeis homeobox 2
SynonymsStra10, Meis2, A430109D20Rik, Mrg1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.845) question?
Stock #R6781 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location115863064-116065839 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116049155 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 228 (H228L)
Ref Sequence ENSEMBL: ENSMUSP00000106533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028639] [ENSMUST00000074285] [ENSMUST00000102538] [ENSMUST00000110906] [ENSMUST00000110907] [ENSMUST00000110908]
Predicted Effect probably benign
Transcript: ENSMUST00000028639
AA Change: H228L

PolyPhen 2 Score 0.203 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000028639
Gene: ENSMUSG00000027210
AA Change: H228L

DomainStartEndE-ValueType
Pfam:Meis_PKNOX_N 110 194 3.8e-48 PFAM
HOX 276 341 4.27e-12 SMART
low complexity region 395 402 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074285
AA Change: H227L

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000073898
Gene: ENSMUSG00000027210
AA Change: H227L

DomainStartEndE-ValueType
HOX 275 340 4.27e-12 SMART
low complexity region 375 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102538
AA Change: H228L

PolyPhen 2 Score 0.203 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099597
Gene: ENSMUSG00000027210
AA Change: H228L

DomainStartEndE-ValueType
HOX 276 341 4.27e-12 SMART
low complexity region 388 395 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110906
AA Change: H227L

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000106531
Gene: ENSMUSG00000027210
AA Change: H227L

DomainStartEndE-ValueType
HOX 275 340 4.27e-12 SMART
low complexity region 382 395 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110907
AA Change: H228L

PolyPhen 2 Score 0.203 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106532
Gene: ENSMUSG00000027210
AA Change: H228L

DomainStartEndE-ValueType
HOX 276 341 4.27e-12 SMART
low complexity region 383 396 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110908
AA Change: H228L

PolyPhen 2 Score 0.203 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106533
Gene: ENSMUSG00000027210
AA Change: H228L

DomainStartEndE-ValueType
HOX 276 341 4.27e-12 SMART
low complexity region 376 389 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: This gene encodes a homeobox protein belonging to the TALE ('three amino acid loop extension') family of homeodomain-containing proteins. TALE homeobox proteins are highly conserved transcriptional regulators and several members have been shown to be essential contributors to developmental programs. In mice, a knock-out of this gene leads to lethality at embryonic day 14, accompanied with hemorrhaging. Embryos lacking this gene show defects in tissues derived from the neural crest, suggesting a critical role of this gene during cranial and cardiac neural crest cell development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a null allele display early fetal lethality with hemorrhaging, persistent truncus arteriosis, absence of cardic valves and defects in other neural crest cell derived tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,374,406 I259N possibly damaging Het
Acot12 G T 13: 91,784,412 probably null Het
AI182371 G T 2: 35,084,705 probably benign Het
Amigo3 T C 9: 108,053,963 L195P probably damaging Het
Aox4 A T 1: 58,245,109 D556V probably benign Het
Arhgef40 A C 14: 51,997,897 probably benign Het
Asb15 T C 6: 24,558,675 V63A probably benign Het
Bicd1 T C 6: 149,513,166 I459T possibly damaging Het
Bub1 C A 2: 127,807,857 G694W probably damaging Het
C4b A T 17: 34,742,954 I106N probably damaging Het
Clca4b T C 3: 144,922,801 I382V probably benign Het
Cntnap5a A C 1: 116,292,397 S646R probably benign Het
Cntnap5c C T 17: 58,138,653 Q563* probably null Het
Cpn1 A G 19: 43,980,904 F107L possibly damaging Het
Csrnp3 T A 2: 66,022,271 C336S probably benign Het
Defa3 T A 8: 21,288,261 M87K probably benign Het
Dmbt1 T C 7: 131,046,561 F274L probably benign Het
Dnah8 TTA TTATA 17: 30,765,724 probably null Het
Dnase2b T C 3: 146,582,371 H323R probably benign Het
Fam83e A T 7: 45,722,147 probably benign Het
Fbn1 T C 2: 125,317,038 N2269S probably damaging Het
Foxa1 A T 12: 57,543,257 M59K possibly damaging Het
Fpr3 T C 17: 17,970,716 V83A probably benign Het
Frmd6 A G 12: 70,899,643 D615G possibly damaging Het
Gfra3 T C 18: 34,711,322 K55R possibly damaging Het
Gm5414 A T 15: 101,625,661 S296T possibly damaging Het
Gtf3c1 T A 7: 125,659,197 K1234* probably null Het
Hltf T A 3: 20,098,166 Y609N probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ift74 A G 4: 94,627,302 D152G probably damaging Het
Kcnk6 T C 7: 29,225,055 Y308C probably damaging Het
Klhl29 A G 12: 5,091,347 S546P probably damaging Het
Map7d1 AGGGCAGCC AGGGCAGCCGGGCAGCC 4: 126,240,751 probably null Het
Mfsd10 A T 5: 34,634,509 M344K possibly damaging Het
Mrps33 T C 6: 39,805,823 probably benign Het
Olfr1198 A T 2: 88,746,830 N19K probably benign Het
Olfr437 A G 6: 43,167,388 E110G probably damaging Het
Pik3cb T C 9: 99,040,992 T996A possibly damaging Het
Plekha7 A G 7: 116,157,855 probably null Het
Ppp1cb A G 5: 32,480,762 Y86C probably damaging Het
Sass6 T G 3: 116,595,124 probably benign Het
Slc6a15 A T 10: 103,395,067 I218F probably damaging Het
St5 T C 7: 109,525,304 D1110G possibly damaging Het
Tcf23 C T 5: 30,968,960 P61L probably benign Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zc3h6 T C 2: 129,015,421 F620S probably damaging Het
Other mutations in Meis2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Meis2 APN 2 115868793 missense probably damaging 1.00
IGL00708:Meis2 APN 2 115864244 missense probably benign 0.11
IGL01095:Meis2 APN 2 115864424 missense probably benign
IGL02199:Meis2 APN 2 116000256 missense probably benign 0.01
IGL02562:Meis2 APN 2 116049146 missense probably damaging 1.00
IGL02902:Meis2 APN 2 116063323 missense probably damaging 0.96
IGL03183:Meis2 APN 2 116059521 missense probably damaging 0.98
IGL03205:Meis2 APN 2 115864250 missense probably benign 0.08
P4748:Meis2 UTSW 2 115864480 missense probably benign 0.03
R0369:Meis2 UTSW 2 116063416 missense possibly damaging 0.82
R0410:Meis2 UTSW 2 115864228 makesense probably null
R1465:Meis2 UTSW 2 116058670 missense probably benign 0.03
R1465:Meis2 UTSW 2 116058670 missense probably benign 0.03
R1548:Meis2 UTSW 2 116058702 missense probably damaging 0.97
R1593:Meis2 UTSW 2 116000264 missense probably damaging 1.00
R3835:Meis2 UTSW 2 115921747 missense probably damaging 1.00
R4353:Meis2 UTSW 2 116059563 missense probably damaging 0.99
R4756:Meis2 UTSW 2 116000205 missense probably damaging 1.00
R4936:Meis2 UTSW 2 115864412 missense probably benign
R5841:Meis2 UTSW 2 116058664 missense probably benign
R5967:Meis2 UTSW 2 115864309 missense probably benign 0.04
R6661:Meis2 UTSW 2 115864270 missense probably damaging 0.97
R7239:Meis2 UTSW 2 116059003 intron probably null
R7606:Meis2 UTSW 2 116063320 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGGAAACCTGTCTTCCTATCAAAAG -3'
(R):5'- CACAGATTAGCATGCCCGTG -3'

Sequencing Primer
(F):5'- AGTAATACTCCCTACACCTTCCTTAG -3'
(R):5'- CGTGGCCACTTCTGAAAATAC -3'
Posted On2018-08-29