Incidental Mutation 'R6781:Dnase2b'
ID531408
Institutional Source Beutler Lab
Gene Symbol Dnase2b
Ensembl Gene ENSMUSG00000028185
Gene Namedeoxyribonuclease II beta
SynonymsDlad, DnaseIIb
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R6781 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location146580985-146615596 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 146582371 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 323 (H323R)
Ref Sequence ENSEMBL: ENSMUSP00000142872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029836] [ENSMUST00000199489] [ENSMUST00000200633]
Predicted Effect probably benign
Transcript: ENSMUST00000029836
AA Change: H323R

PolyPhen 2 Score 0.396 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000029836
Gene: ENSMUSG00000028185
AA Change: H323R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DNase_II 27 353 1.5e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199489
SMART Domains Protein: ENSMUSP00000143418
Gene: ENSMUSG00000028186

DomainStartEndE-ValueType
Pfam:Uricase 1 121 8.3e-35 PFAM
Pfam:Uricase 128 228 1.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200633
AA Change: H323R

PolyPhen 2 Score 0.396 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000142872
Gene: ENSMUSG00000028185
AA Change: H323R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DNase_II 26 353 4.5e-117 PFAM
Meta Mutation Damage Score 0.2339 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares considerable sequence similarity to, and is structurally related to DNase II. The latter is a well characterized endonuclease that catalyzes DNA hydrolysis in the absence of divalent cations at acidic pH. Unlike DNase II which is ubiquitously expressed, expression of this gene product is restricted to the salivary gland and lungs. The gene has been localized to chromosome 1p22.3 adjacent (and in opposite orientation) to the uricase pseudogene. Two transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: The inability of homozygous mutant mice to degrade DNA in differentiating lens cells leads to cataract formation in the nucleus lentis. Consequently, mutant mice exhibit an impaired response to light. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,374,406 I259N possibly damaging Het
Acot12 G T 13: 91,784,412 probably null Het
AI182371 G T 2: 35,084,705 probably benign Het
Amigo3 T C 9: 108,053,963 L195P probably damaging Het
Aox4 A T 1: 58,245,109 D556V probably benign Het
Arhgef40 A C 14: 51,997,897 probably benign Het
Asb15 T C 6: 24,558,675 V63A probably benign Het
Bicd1 T C 6: 149,513,166 I459T possibly damaging Het
Bub1 C A 2: 127,807,857 G694W probably damaging Het
C4b A T 17: 34,742,954 I106N probably damaging Het
Clca4b T C 3: 144,922,801 I382V probably benign Het
Cntnap5a A C 1: 116,292,397 S646R probably benign Het
Cntnap5c C T 17: 58,138,653 Q563* probably null Het
Cpn1 A G 19: 43,980,904 F107L possibly damaging Het
Csrnp3 T A 2: 66,022,271 C336S probably benign Het
Defa3 T A 8: 21,288,261 M87K probably benign Het
Dmbt1 T C 7: 131,046,561 F274L probably benign Het
Dnah8 TTA TTATA 17: 30,765,724 probably null Het
Fam83e A T 7: 45,722,147 probably benign Het
Fbn1 T C 2: 125,317,038 N2269S probably damaging Het
Foxa1 A T 12: 57,543,257 M59K possibly damaging Het
Fpr3 T C 17: 17,970,716 V83A probably benign Het
Frmd6 A G 12: 70,899,643 D615G possibly damaging Het
Gfra3 T C 18: 34,711,322 K55R possibly damaging Het
Gm5414 A T 15: 101,625,661 S296T possibly damaging Het
Gtf3c1 T A 7: 125,659,197 K1234* probably null Het
Hltf T A 3: 20,098,166 Y609N probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ift74 A G 4: 94,627,302 D152G probably damaging Het
Kcnk6 T C 7: 29,225,055 Y308C probably damaging Het
Klhl29 A G 12: 5,091,347 S546P probably damaging Het
Map7d1 AGGGCAGCC AGGGCAGCCGGGCAGCC 4: 126,240,751 probably null Het
Meis2 T A 2: 116,049,155 H228L probably benign Het
Mfsd10 A T 5: 34,634,509 M344K possibly damaging Het
Mrps33 T C 6: 39,805,823 probably benign Het
Olfr1198 A T 2: 88,746,830 N19K probably benign Het
Olfr437 A G 6: 43,167,388 E110G probably damaging Het
Pik3cb T C 9: 99,040,992 T996A possibly damaging Het
Plekha7 A G 7: 116,157,855 probably null Het
Ppp1cb A G 5: 32,480,762 Y86C probably damaging Het
Sass6 T G 3: 116,595,124 probably benign Het
Slc6a15 A T 10: 103,395,067 I218F probably damaging Het
St5 T C 7: 109,525,304 D1110G possibly damaging Het
Tcf23 C T 5: 30,968,960 P61L probably benign Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zc3h6 T C 2: 129,015,421 F620S probably damaging Het
Other mutations in Dnase2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Dnase2b APN 3 146596378 missense probably benign 0.34
IGL01626:Dnase2b APN 3 146584616 intron probably null
IGL02582:Dnase2b APN 3 146589085 missense probably benign 0.00
IGL02970:Dnase2b APN 3 146582506 missense probably damaging 0.97
R0006:Dnase2b UTSW 3 146582489 missense probably damaging 0.99
R0006:Dnase2b UTSW 3 146582489 missense probably damaging 0.99
R0233:Dnase2b UTSW 3 146582550 missense probably benign 0.01
R0233:Dnase2b UTSW 3 146582550 missense probably benign 0.01
R0539:Dnase2b UTSW 3 146589155 splice site probably benign
R1544:Dnase2b UTSW 3 146584557 missense probably benign 0.03
R2201:Dnase2b UTSW 3 146584688 missense probably damaging 0.99
R3690:Dnase2b UTSW 3 146593571 nonsense probably null
R4921:Dnase2b UTSW 3 146593441 missense probably damaging 1.00
R5318:Dnase2b UTSW 3 146582455 missense probably benign 0.02
R6226:Dnase2b UTSW 3 146584563 missense probably benign
R6593:Dnase2b UTSW 3 146586911 missense probably damaging 1.00
R7035:Dnase2b UTSW 3 146582341 missense probably damaging 1.00
R7314:Dnase2b UTSW 3 146582396 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTGCTCACTCAGAAGCCTTG -3'
(R):5'- TGTTAGCACAAACCTGGCAG -3'

Sequencing Primer
(F):5'- CACTCAGAAGCCTTGAAATTATGGAG -3'
(R):5'- TGTTAGCACAAACCTGGCAGAAAAAG -3'
Posted On2018-08-29