Incidental Mutation 'R6781:Ift74'
ID531409
Institutional Source Beutler Lab
Gene Symbol Ift74
Ensembl Gene ENSMUSG00000028576
Gene Nameintraflagellar transport 74
SynonymsCmg1, 1700029H06Rik, Ccdc2, b2b796Clo
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_026319.2; MGI: 1914944

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6781 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location94614491-94693229 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94627302 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 152 (D152G)
Ref Sequence ENSEMBL: ENSMUSP00000102721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030311] [ENSMUST00000107104]
Predicted Effect probably damaging
Transcript: ENSMUST00000030311
AA Change: D152G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030311
Gene: ENSMUSG00000028576
AA Change: D152G

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
low complexity region 47 62 N/A INTRINSIC
coiled coil region 98 271 N/A INTRINSIC
coiled coil region 302 382 N/A INTRINSIC
coiled coil region 430 490 N/A INTRINSIC
coiled coil region 512 546 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107104
AA Change: D152G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102721
Gene: ENSMUSG00000028576
AA Change: D152G

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
low complexity region 47 62 N/A INTRINSIC
coiled coil region 98 271 N/A INTRINSIC
coiled coil region 302 352 N/A INTRINSIC
Meta Mutation Damage Score 0.6319 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (45/46)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit complex congenital heart disease associated with heterotaxy. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted(2) Gene trapped(21)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,374,406 I259N possibly damaging Het
Acot12 G T 13: 91,784,412 probably null Het
AI182371 G T 2: 35,084,705 probably benign Het
Amigo3 T C 9: 108,053,963 L195P probably damaging Het
Aox4 A T 1: 58,245,109 D556V probably benign Het
Arhgef40 A C 14: 51,997,897 probably benign Het
Asb15 T C 6: 24,558,675 V63A probably benign Het
Bicd1 T C 6: 149,513,166 I459T possibly damaging Het
Bub1 C A 2: 127,807,857 G694W probably damaging Het
C4b A T 17: 34,742,954 I106N probably damaging Het
Clca4b T C 3: 144,922,801 I382V probably benign Het
Cntnap5a A C 1: 116,292,397 S646R probably benign Het
Cntnap5c C T 17: 58,138,653 Q563* probably null Het
Cpn1 A G 19: 43,980,904 F107L possibly damaging Het
Csrnp3 T A 2: 66,022,271 C336S probably benign Het
Defa3 T A 8: 21,288,261 M87K probably benign Het
Dmbt1 T C 7: 131,046,561 F274L probably benign Het
Dnah8 TTA TTATA 17: 30,765,724 probably null Het
Dnase2b T C 3: 146,582,371 H323R probably benign Het
Fam83e A T 7: 45,722,147 probably benign Het
Fbn1 T C 2: 125,317,038 N2269S probably damaging Het
Foxa1 A T 12: 57,543,257 M59K possibly damaging Het
Fpr3 T C 17: 17,970,716 V83A probably benign Het
Frmd6 A G 12: 70,899,643 D615G possibly damaging Het
Gfra3 T C 18: 34,711,322 K55R possibly damaging Het
Gm5414 A T 15: 101,625,661 S296T possibly damaging Het
Gtf3c1 T A 7: 125,659,197 K1234* probably null Het
Hltf T A 3: 20,098,166 Y609N probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Kcnk6 T C 7: 29,225,055 Y308C probably damaging Het
Klhl29 A G 12: 5,091,347 S546P probably damaging Het
Map7d1 AGGGCAGCC AGGGCAGCCGGGCAGCC 4: 126,240,751 probably null Het
Meis2 T A 2: 116,049,155 H228L probably benign Het
Mfsd10 A T 5: 34,634,509 M344K possibly damaging Het
Mrps33 T C 6: 39,805,823 probably benign Het
Olfr1198 A T 2: 88,746,830 N19K probably benign Het
Olfr437 A G 6: 43,167,388 E110G probably damaging Het
Pik3cb T C 9: 99,040,992 T996A possibly damaging Het
Plekha7 A G 7: 116,157,855 probably null Het
Ppp1cb A G 5: 32,480,762 Y86C probably damaging Het
Sass6 T G 3: 116,595,124 probably benign Het
Slc6a15 A T 10: 103,395,067 I218F probably damaging Het
St5 T C 7: 109,525,304 D1110G possibly damaging Het
Tcf23 C T 5: 30,968,960 P61L probably benign Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zc3h6 T C 2: 129,015,421 F620S probably damaging Het
Other mutations in Ift74
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Ift74 APN 4 94693022 missense probably damaging 1.00
IGL01534:Ift74 APN 4 94679944 missense probably benign 0.00
IGL01701:Ift74 APN 4 94662658 missense possibly damaging 0.94
IGL02155:Ift74 APN 4 94679251 missense probably benign
IGL02455:Ift74 APN 4 94635831 nonsense probably null
IGL02877:Ift74 APN 4 94624781 critical splice donor site probably null
IGL03389:Ift74 APN 4 94621912 missense possibly damaging 0.57
P0005:Ift74 UTSW 4 94662576 splice site probably benign
PIT4243001:Ift74 UTSW 4 94686904 missense possibly damaging 0.94
R0211:Ift74 UTSW 4 94679255 missense probably benign 0.05
R0211:Ift74 UTSW 4 94679255 missense probably benign 0.05
R1019:Ift74 UTSW 4 94635835 missense probably benign 0.20
R1240:Ift74 UTSW 4 94692937 splice site probably null
R1699:Ift74 UTSW 4 94685703 missense probably benign 0.09
R1937:Ift74 UTSW 4 94662646 missense probably benign 0.10
R2114:Ift74 UTSW 4 94627259 missense probably benign 0.00
R2116:Ift74 UTSW 4 94627259 missense probably benign 0.00
R2117:Ift74 UTSW 4 94627259 missense probably benign 0.00
R2181:Ift74 UTSW 4 94632714 missense probably damaging 0.98
R2680:Ift74 UTSW 4 94653028 missense probably damaging 1.00
R3434:Ift74 UTSW 4 94621852 critical splice acceptor site probably null
R3435:Ift74 UTSW 4 94621852 critical splice acceptor site probably null
R4080:Ift74 UTSW 4 94652912 splice site probably null
R4379:Ift74 UTSW 4 94679934 missense probably benign 0.00
R4777:Ift74 UTSW 4 94652997 missense probably benign 0.00
R5197:Ift74 UTSW 4 94662596 missense probably benign 0.00
R5934:Ift74 UTSW 4 94632734 missense probably benign
R5994:Ift74 UTSW 4 94691724 missense possibly damaging 0.86
R6639:Ift74 UTSW 4 94664259 intron probably benign
R7156:Ift74 UTSW 4 94660952 missense possibly damaging 0.95
R7239:Ift74 UTSW 4 94652950 missense probably benign 0.00
R7899:Ift74 UTSW 4 94621977 missense possibly damaging 0.90
R7982:Ift74 UTSW 4 94621977 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CTTTTCTGAGTTAGAAGCATTGCTG -3'
(R):5'- GCCAAGTTATTTCTGGGGAAAG -3'

Sequencing Primer
(F):5'- CTGAGTTAGAAGCATTGCTGAATTTC -3'
(R):5'- ACAGCGGATCCCATTACAGGTG -3'
Posted On2018-08-29