Incidental Mutation 'R6781:Kcnk6'
ID531417
Institutional Source Beutler Lab
Gene Symbol Kcnk6
Ensembl Gene ENSMUSG00000046410
Gene Namepotassium inwardly-rectifying channel, subfamily K, member 6
SynonymsTwik2, Toss, D7Ertd764e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R6781 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location29221926-29232515 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29225055 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 308 (Y308C)
Ref Sequence ENSEMBL: ENSMUSP00000082975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085818]
Predicted Effect probably damaging
Transcript: ENSMUST00000085818
AA Change: Y308C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082975
Gene: ENSMUSG00000046410
AA Change: Y308C

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Ion_trans_2 74 146 1.6e-17 PFAM
Pfam:Ion_trans_2 180 260 2.1e-21 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the members of the superfamily of potassium channel proteins containing two pore-forming P domains. This channel protein, considered an open rectifier, is widely expressed. It is stimulated by arachidonic acid, and inhibited by internal acidification and volatile anaesthetics. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele exhibit vascular dysfunction and hypertension. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,374,406 I259N possibly damaging Het
Acot12 G T 13: 91,784,412 probably null Het
AI182371 G T 2: 35,084,705 probably benign Het
Amigo3 T C 9: 108,053,963 L195P probably damaging Het
Aox4 A T 1: 58,245,109 D556V probably benign Het
Arhgef40 A C 14: 51,997,897 probably benign Het
Asb15 T C 6: 24,558,675 V63A probably benign Het
Bicd1 T C 6: 149,513,166 I459T possibly damaging Het
Bub1 C A 2: 127,807,857 G694W probably damaging Het
C4b A T 17: 34,742,954 I106N probably damaging Het
Clca4b T C 3: 144,922,801 I382V probably benign Het
Cntnap5a A C 1: 116,292,397 S646R probably benign Het
Cntnap5c C T 17: 58,138,653 Q563* probably null Het
Cpn1 A G 19: 43,980,904 F107L possibly damaging Het
Csrnp3 T A 2: 66,022,271 C336S probably benign Het
Defa3 T A 8: 21,288,261 M87K probably benign Het
Dmbt1 T C 7: 131,046,561 F274L probably benign Het
Dnah8 TTA TTATA 17: 30,765,724 probably null Het
Dnase2b T C 3: 146,582,371 H323R probably benign Het
Fam83e A T 7: 45,722,147 probably benign Het
Fbn1 T C 2: 125,317,038 N2269S probably damaging Het
Foxa1 A T 12: 57,543,257 M59K possibly damaging Het
Fpr3 T C 17: 17,970,716 V83A probably benign Het
Frmd6 A G 12: 70,899,643 D615G possibly damaging Het
Gfra3 T C 18: 34,711,322 K55R possibly damaging Het
Gm5414 A T 15: 101,625,661 S296T possibly damaging Het
Gtf3c1 T A 7: 125,659,197 K1234* probably null Het
Hltf T A 3: 20,098,166 Y609N probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ift74 A G 4: 94,627,302 D152G probably damaging Het
Klhl29 A G 12: 5,091,347 S546P probably damaging Het
Map7d1 AGGGCAGCC AGGGCAGCCGGGCAGCC 4: 126,240,751 probably null Het
Meis2 T A 2: 116,049,155 H228L probably benign Het
Mfsd10 A T 5: 34,634,509 M344K possibly damaging Het
Mrps33 T C 6: 39,805,823 probably benign Het
Olfr1198 A T 2: 88,746,830 N19K probably benign Het
Olfr437 A G 6: 43,167,388 E110G probably damaging Het
Pik3cb T C 9: 99,040,992 T996A possibly damaging Het
Plekha7 A G 7: 116,157,855 probably null Het
Ppp1cb A G 5: 32,480,762 Y86C probably damaging Het
Sass6 T G 3: 116,595,124 probably benign Het
Slc6a15 A T 10: 103,395,067 I218F probably damaging Het
St5 T C 7: 109,525,304 D1110G possibly damaging Het
Tcf23 C T 5: 30,968,960 P61L probably benign Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zc3h6 T C 2: 129,015,421 F620S probably damaging Het
Other mutations in Kcnk6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02419:Kcnk6 APN 7 29225202 missense probably benign 0.01
R0057:Kcnk6 UTSW 7 29225663 missense probably damaging 1.00
R0113:Kcnk6 UTSW 7 29232209 missense probably damaging 1.00
R1888:Kcnk6 UTSW 7 29225650 missense probably benign 0.13
R1888:Kcnk6 UTSW 7 29225650 missense probably benign 0.13
R7250:Kcnk6 UTSW 7 29232194 missense probably benign 0.34
R7782:Kcnk6 UTSW 7 29225844 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ATGACTGTGTCAGTGCCCTG -3'
(R):5'- CCATGTCTACAGCGTACCTC -3'

Sequencing Primer
(F):5'- TCAGTGCCCTGAGGAGCAG -3'
(R):5'- CCTGGTTGCCATGGTGCTC -3'
Posted On2018-08-29