Mutagenetix > Incidental Mutation

Incidental Mutation 'R6781:Slc6a15'

531426

Institutional Source

Beutler Lab

Gene Symbol

Slc6a15

Ensembl Gene

ENSMUSG00000019894

Gene Name

solute carrier family 6 (neurotransmitter transporter), member 15

Synonyms

v7-3

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6781 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

103367783-103419377 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 103395067 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 218 (I218F)

Ref Sequence

ENSEMBL: ENSMUSP00000136676 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074204] [ENSMUST00000179636] [ENSMUST00000217905]

AlphaFold

Q8BG16

Predicted Effect

probably damaging
Transcript: ENSMUST00000074204
AA Change: I218F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000073829
Gene: ENSMUSG00000019894
AA Change: I218F

Domain	Start	End	E-Value	Type
low complexity region	29	38	N/A	INTRINSIC
Pfam:SNF	61	644	2.2e-229	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000179636
AA Change: I218F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000136676
Gene: ENSMUSG00000019894
AA Change: I218F

Domain	Start	End	E-Value	Type
low complexity region	29	38	N/A	INTRINSIC
Pfam:SNF	61	644	2.2e-229	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000217905

Meta Mutation Damage Score

0.5476

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.4%

Validation Efficiency

98% (45/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the solute carrier family 6 protein family which transports neutral amino acids. The encoded protein is thought to play a role in neuronal amino acid transport (PMID: 16185194) and may be associated with major depression (PMID: 21521612). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased synaptosome transport activities but exhibit no behavioral abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	T	A	17: 24,374,406	I259N	possibly damaging	Het
Acot12	G	T	13: 91,784,412		probably null	Het
AI182371	G	T	2: 35,084,705		probably benign	Het
Amigo3	T	C	9: 108,053,963	L195P	probably damaging	Het
Aox4	A	T	1: 58,245,109	D556V	probably benign	Het
Arhgef40	A	C	14: 51,997,897		probably benign	Het
Asb15	T	C	6: 24,558,675	V63A	probably benign	Het
Bicd1	T	C	6: 149,513,166	I459T	possibly damaging	Het
Bub1	C	A	2: 127,807,857	G694W	probably damaging	Het
C4b	A	T	17: 34,742,954	I106N	probably damaging	Het
Clca4b	T	C	3: 144,922,801	I382V	probably benign	Het
Cntnap5a	A	C	1: 116,292,397	S646R	probably benign	Het
Cntnap5c	C	T	17: 58,138,653	Q563*	probably null	Het
Cpn1	A	G	19: 43,980,904	F107L	possibly damaging	Het
Csrnp3	T	A	2: 66,022,271	C336S	probably benign	Het
Defa3	T	A	8: 21,288,261	M87K	probably benign	Het
Dmbt1	T	C	7: 131,046,561	F274L	probably benign	Het
Dnah8	TTA	TTATA	17: 30,765,724		probably null	Het
Dnase2b	T	C	3: 146,582,371	H323R	probably benign	Het
Fam83e	A	T	7: 45,722,147		probably benign	Het
Fbn1	T	C	2: 125,317,038	N2269S	probably damaging	Het
Foxa1	A	T	12: 57,543,257	M59K	possibly damaging	Het
Fpr3	T	C	17: 17,970,716	V83A	probably benign	Het
Frmd6	A	G	12: 70,899,643	D615G	possibly damaging	Het
Gfra3	T	C	18: 34,711,322	K55R	possibly damaging	Het
Gm5414	A	T	15: 101,625,661	S296T	possibly damaging	Het
Gtf3c1	T	A	7: 125,659,197	K1234*	probably null	Het
Hltf	T	A	3: 20,098,166	Y609N	probably benign	Het
Idh2	TCCCAGG	T	7: 80,098,331		probably benign	Het
Ift74	A	G	4: 94,627,302	D152G	probably damaging	Het
Kcnk6	T	C	7: 29,225,055	Y308C	probably damaging	Het
Klhl29	A	G	12: 5,091,347	S546P	probably damaging	Het
Map7d1	AGGGCAGCC	AGGGCAGCCGGGCAGCC	4: 126,240,751		probably null	Het
Meis2	T	A	2: 116,049,155	H228L	probably benign	Het
Mfsd10	A	T	5: 34,634,509	M344K	possibly damaging	Het
Mrps33	T	C	6: 39,805,823		probably benign	Het
Olfr1198	A	T	2: 88,746,830	N19K	probably benign	Het
Olfr437	A	G	6: 43,167,388	E110G	probably damaging	Het
Pik3cb	T	C	9: 99,040,992	T996A	possibly damaging	Het
Plekha7	A	G	7: 116,157,855		probably null	Het
Ppp1cb	A	G	5: 32,480,762	Y86C	probably damaging	Het
Sass6	T	G	3: 116,595,124		probably benign	Het
St5	T	C	7: 109,525,304	D1110G	possibly damaging	Het
Tcf23	C	T	5: 30,968,960	P61L	probably benign	Het
Yod1	G	A	1: 130,717,538	G19S	probably damaging	Het
Zc3h6	T	C	2: 129,015,421	F620S	probably damaging	Het

Other mutations in Slc6a15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Slc6a15	APN	10	103389141	missense	probably benign
IGL01320:Slc6a15	APN	10	103404745	missense	probably benign	0.00
IGL01924:Slc6a15	APN	10	103404825	splice site	probably null
IGL02066:Slc6a15	APN	10	103416658	missense	probably damaging	0.98
IGL02164:Slc6a15	APN	10	103418222	missense	probably benign	0.01
IGL02551:Slc6a15	APN	10	103404275	splice site	probably benign
IGL02744:Slc6a15	APN	10	103418033	missense	probably benign	0.03
R0028:Slc6a15	UTSW	10	103416680	missense	probably benign	0.00
R0143:Slc6a15	UTSW	10	103418068	missense	probably benign	0.02
R0158:Slc6a15	UTSW	10	103389347	splice site	probably benign
R0165:Slc6a15	UTSW	10	103409809	missense	probably null	0.04
R0349:Slc6a15	UTSW	10	103418225	missense	probably benign	0.06
R0383:Slc6a15	UTSW	10	103418053	missense	probably damaging	1.00
R0614:Slc6a15	UTSW	10	103404352	nonsense	probably null
R0784:Slc6a15	UTSW	10	103416800	splice site	probably benign
R0944:Slc6a15	UTSW	10	103409796	missense	probably benign	0.01
R1795:Slc6a15	UTSW	10	103400260	missense	probably benign
R1882:Slc6a15	UTSW	10	103395064	missense	probably benign	0.20
R2061:Slc6a15	UTSW	10	103409734	missense	probably benign	0.20
R2156:Slc6a15	UTSW	10	103393408	missense	probably damaging	1.00
R2358:Slc6a15	UTSW	10	103416785	missense	probably benign	0.00
R2849:Slc6a15	UTSW	10	103404691	missense	probably benign	0.01
R2921:Slc6a15	UTSW	10	103418387	missense	probably damaging	0.99
R3709:Slc6a15	UTSW	10	103393414	missense	probably benign	0.00
R4532:Slc6a15	UTSW	10	103409787	missense	possibly damaging	0.69
R4825:Slc6a15	UTSW	10	103418060	missense	probably benign	0.05
R4909:Slc6a15	UTSW	10	103404414	missense	probably damaging	1.00
R5112:Slc6a15	UTSW	10	103389226	missense	probably benign
R5320:Slc6a15	UTSW	10	103408206	missense	probably damaging	1.00
R5364:Slc6a15	UTSW	10	103393508	missense	probably damaging	0.99
R6305:Slc6a15	UTSW	10	103389170	missense	probably benign	0.31
R6348:Slc6a15	UTSW	10	103404367	missense	probably damaging	1.00
R6729:Slc6a15	UTSW	10	103393914	missense	probably damaging	0.99
R7409:Slc6a15	UTSW	10	103408302	missense	probably benign
R7549:Slc6a15	UTSW	10	103389137	missense	probably benign
R7660:Slc6a15	UTSW	10	103393380	splice site	probably null
R7839:Slc6a15	UTSW	10	103404799	missense	probably benign
R7948:Slc6a15	UTSW	10	103404295	missense	possibly damaging	0.95
R8278:Slc6a15	UTSW	10	103394029	critical splice donor site	probably null
R8379:Slc6a15	UTSW	10	103389187	missense	probably benign	0.00
R8685:Slc6a15	UTSW	10	103409695	missense	possibly damaging	0.68
R8712:Slc6a15	UTSW	10	103389251	missense	probably damaging	1.00
R8719:Slc6a15	UTSW	10	103404315	missense	probably damaging	0.99
R8832:Slc6a15	UTSW	10	103389318	missense	probably damaging	1.00
R8940:Slc6a15	UTSW	10	103393496	missense	probably damaging	1.00
R8978:Slc6a15	UTSW	10	103395092	nonsense	probably null
R9050:Slc6a15	UTSW	10	103416655	missense	possibly damaging	0.88
R9113:Slc6a15	UTSW	10	103400279	missense	probably damaging	1.00
R9242:Slc6a15	UTSW	10	103393545	nonsense	probably null
R9493:Slc6a15	UTSW	10	103393416	missense	probably benign	0.35
R9529:Slc6a15	UTSW	10	103404722	missense	probably benign	0.14
R9532:Slc6a15	UTSW	10	103404472	missense	probably damaging	0.98
RF013:Slc6a15	UTSW	10	103400216	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGAACTGGCTAATGGGCTTG -3'
(R):5'- GTAGATGCCTAGACAAAGTAGTCAAAC -3'

Sequencing Primer
(F):5'- GCTAATGGGCTTGTGGGAC -3'
(R):5'- AACAATTTGTCATTTGAATTTGGGGG -3'

Posted On

2018-08-29