Incidental Mutation 'R6781:Foxa1'
ID531428
Institutional Source Beutler Lab
Gene Symbol Foxa1
Ensembl Gene ENSMUSG00000035451
Gene Nameforkhead box A1
SynonymsHnf3a, Hnf-3a, Tcf3a, Tcf-3a
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6781 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location57540628-57546916 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57543257 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 59 (M59K)
Ref Sequence ENSEMBL: ENSMUSP00000041118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044380]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044380
AA Change: M59K

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000041118
Gene: ENSMUSG00000035451
AA Change: M59K

DomainStartEndE-ValueType
low complexity region 32 60 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
FH 168 258 3.88e-62 SMART
low complexity region 273 286 N/A INTRINSIC
low complexity region 318 328 N/A INTRINSIC
low complexity region 347 365 N/A INTRINSIC
Pfam:HNF_C 393 457 1.3e-30 PFAM
Meta Mutation Damage Score 0.1187 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the forkhead class of DNA-binding proteins. These hepatocyte nuclear factors are transcriptional activators for liver-specific transcripts such as albumin and transthyretin, and they also interact with chromatin. Similar family members in mice have roles in the regulation of metabolism and in the differentiation of the pancreas and liver. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit abnormal feeding, hypoglycemia, impaired glucagon secretion, hypotryglyceridemia, wasting, and lethality between postnatal days 2 and 14. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,374,406 I259N possibly damaging Het
Acot12 G T 13: 91,784,412 probably null Het
AI182371 G T 2: 35,084,705 probably benign Het
Amigo3 T C 9: 108,053,963 L195P probably damaging Het
Aox4 A T 1: 58,245,109 D556V probably benign Het
Arhgef40 A C 14: 51,997,897 probably benign Het
Asb15 T C 6: 24,558,675 V63A probably benign Het
Bicd1 T C 6: 149,513,166 I459T possibly damaging Het
Bub1 C A 2: 127,807,857 G694W probably damaging Het
C4b A T 17: 34,742,954 I106N probably damaging Het
Clca4b T C 3: 144,922,801 I382V probably benign Het
Cntnap5a A C 1: 116,292,397 S646R probably benign Het
Cntnap5c C T 17: 58,138,653 Q563* probably null Het
Cpn1 A G 19: 43,980,904 F107L possibly damaging Het
Csrnp3 T A 2: 66,022,271 C336S probably benign Het
Defa3 T A 8: 21,288,261 M87K probably benign Het
Dmbt1 T C 7: 131,046,561 F274L probably benign Het
Dnah8 TTA TTATA 17: 30,765,724 probably null Het
Dnase2b T C 3: 146,582,371 H323R probably benign Het
Fam83e A T 7: 45,722,147 probably benign Het
Fbn1 T C 2: 125,317,038 N2269S probably damaging Het
Fpr3 T C 17: 17,970,716 V83A probably benign Het
Frmd6 A G 12: 70,899,643 D615G possibly damaging Het
Gfra3 T C 18: 34,711,322 K55R possibly damaging Het
Gm5414 A T 15: 101,625,661 S296T possibly damaging Het
Gtf3c1 T A 7: 125,659,197 K1234* probably null Het
Hltf T A 3: 20,098,166 Y609N probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ift74 A G 4: 94,627,302 D152G probably damaging Het
Kcnk6 T C 7: 29,225,055 Y308C probably damaging Het
Klhl29 A G 12: 5,091,347 S546P probably damaging Het
Map7d1 AGGGCAGCC AGGGCAGCCGGGCAGCC 4: 126,240,751 probably null Het
Meis2 T A 2: 116,049,155 H228L probably benign Het
Mfsd10 A T 5: 34,634,509 M344K possibly damaging Het
Mrps33 T C 6: 39,805,823 probably benign Het
Olfr1198 A T 2: 88,746,830 N19K probably benign Het
Olfr437 A G 6: 43,167,388 E110G probably damaging Het
Pik3cb T C 9: 99,040,992 T996A possibly damaging Het
Plekha7 A G 7: 116,157,855 probably null Het
Ppp1cb A G 5: 32,480,762 Y86C probably damaging Het
Sass6 T G 3: 116,595,124 probably benign Het
Slc6a15 A T 10: 103,395,067 I218F probably damaging Het
St5 T C 7: 109,525,304 D1110G possibly damaging Het
Tcf23 C T 5: 30,968,960 P61L probably benign Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zc3h6 T C 2: 129,015,421 F620S probably damaging Het
Other mutations in Foxa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00696:Foxa1 APN 12 57542657 missense probably damaging 1.00
IGL02371:Foxa1 APN 12 57542700 missense probably damaging 0.98
IGL03150:Foxa1 APN 12 57542296 missense probably benign 0.41
PIT4377001:Foxa1 UTSW 12 57542781 missense probably damaging 1.00
R1347:Foxa1 UTSW 12 57542284 missense probably damaging 0.99
R1347:Foxa1 UTSW 12 57542284 missense probably damaging 0.99
R1494:Foxa1 UTSW 12 57542198 missense probably damaging 0.99
R1598:Foxa1 UTSW 12 57542687 missense possibly damaging 0.69
R1809:Foxa1 UTSW 12 57542741 missense probably damaging 1.00
R5554:Foxa1 UTSW 12 57542291 missense probably benign 0.00
R5667:Foxa1 UTSW 12 57542295 missense probably benign 0.01
R5782:Foxa1 UTSW 12 57542516 missense probably benign 0.00
R6174:Foxa1 UTSW 12 57542900 missense probably damaging 1.00
R6750:Foxa1 UTSW 12 57542610 missense probably benign 0.32
R6995:Foxa1 UTSW 12 57542478 missense probably benign 0.00
R7209:Foxa1 UTSW 12 57543291 missense probably benign 0.03
R7864:Foxa1 UTSW 12 57542747 missense probably damaging 1.00
R7947:Foxa1 UTSW 12 57542747 missense probably damaging 1.00
X0020:Foxa1 UTSW 12 57543312 missense possibly damaging 0.73
Z1177:Foxa1 UTSW 12 57542417 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ACTCATGCACGGGTTCATGG -3'
(R):5'- CAGAAATGCTGTTAGCTCGC -3'

Sequencing Primer
(F):5'- CAGGCCGTTCATGGAGGTG -3'
(R):5'- CTGTTAGCTCGCCCCGG -3'
Posted On2018-08-29