Incidental Mutation 'R6781:Frmd6'
ID531429
Institutional Source Beutler Lab
Gene Symbol Frmd6
Ensembl Gene ENSMUSG00000048285
Gene NameFERM domain containing 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6781 (G1)
Quality Score96.0077
Status Validated
Chromosome12
Chromosomal Location70825514-70902234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70899643 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 615 (D615G)
Ref Sequence ENSEMBL: ENSMUSP00000052202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057859]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057859
AA Change: D615G

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000052202
Gene: ENSMUSG00000048285
AA Change: D615G

DomainStartEndE-ValueType
B41 13 234 2.41e-25 SMART
FERM_C 241 332 9.63e-19 SMART
low complexity region 365 375 N/A INTRINSIC
low complexity region 382 395 N/A INTRINSIC
low complexity region 425 442 N/A INTRINSIC
low complexity region 506 512 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,374,406 I259N possibly damaging Het
Acot12 G T 13: 91,784,412 probably null Het
AI182371 G T 2: 35,084,705 probably benign Het
Amigo3 T C 9: 108,053,963 L195P probably damaging Het
Aox4 A T 1: 58,245,109 D556V probably benign Het
Arhgef40 A C 14: 51,997,897 probably benign Het
Asb15 T C 6: 24,558,675 V63A probably benign Het
Bicd1 T C 6: 149,513,166 I459T possibly damaging Het
Bub1 C A 2: 127,807,857 G694W probably damaging Het
C4b A T 17: 34,742,954 I106N probably damaging Het
Clca4b T C 3: 144,922,801 I382V probably benign Het
Cntnap5a A C 1: 116,292,397 S646R probably benign Het
Cntnap5c C T 17: 58,138,653 Q563* probably null Het
Cpn1 A G 19: 43,980,904 F107L possibly damaging Het
Csrnp3 T A 2: 66,022,271 C336S probably benign Het
Defa3 T A 8: 21,288,261 M87K probably benign Het
Dmbt1 T C 7: 131,046,561 F274L probably benign Het
Dnah8 TTA TTATA 17: 30,765,724 probably null Het
Dnase2b T C 3: 146,582,371 H323R probably benign Het
Fam83e A T 7: 45,722,147 probably benign Het
Fbn1 T C 2: 125,317,038 N2269S probably damaging Het
Foxa1 A T 12: 57,543,257 M59K possibly damaging Het
Fpr3 T C 17: 17,970,716 V83A probably benign Het
Gfra3 T C 18: 34,711,322 K55R possibly damaging Het
Gm5414 A T 15: 101,625,661 S296T possibly damaging Het
Gtf3c1 T A 7: 125,659,197 K1234* probably null Het
Hltf T A 3: 20,098,166 Y609N probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ift74 A G 4: 94,627,302 D152G probably damaging Het
Kcnk6 T C 7: 29,225,055 Y308C probably damaging Het
Klhl29 A G 12: 5,091,347 S546P probably damaging Het
Map7d1 AGGGCAGCC AGGGCAGCCGGGCAGCC 4: 126,240,751 probably null Het
Meis2 T A 2: 116,049,155 H228L probably benign Het
Mfsd10 A T 5: 34,634,509 M344K possibly damaging Het
Mrps33 T C 6: 39,805,823 probably benign Het
Olfr1198 A T 2: 88,746,830 N19K probably benign Het
Olfr437 A G 6: 43,167,388 E110G probably damaging Het
Pik3cb T C 9: 99,040,992 T996A possibly damaging Het
Plekha7 A G 7: 116,157,855 probably null Het
Ppp1cb A G 5: 32,480,762 Y86C probably damaging Het
Sass6 T G 3: 116,595,124 probably benign Het
Slc6a15 A T 10: 103,395,067 I218F probably damaging Het
St5 T C 7: 109,525,304 D1110G possibly damaging Het
Tcf23 C T 5: 30,968,960 P61L probably benign Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zc3h6 T C 2: 129,015,421 F620S probably damaging Het
Other mutations in Frmd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0629:Frmd6 UTSW 12 70883762 missense probably damaging 1.00
R0662:Frmd6 UTSW 12 70899444 nonsense probably null
R0747:Frmd6 UTSW 12 70864056 missense probably benign
R1144:Frmd6 UTSW 12 70877168 missense probably damaging 1.00
R1366:Frmd6 UTSW 12 70887889 splice site probably benign
R1763:Frmd6 UTSW 12 70893622 missense possibly damaging 0.90
R2135:Frmd6 UTSW 12 70894997 missense probably benign 0.00
R2342:Frmd6 UTSW 12 70883818 nonsense probably null
R3963:Frmd6 UTSW 12 70893864 missense probably benign 0.00
R3982:Frmd6 UTSW 12 70887834 missense probably damaging 1.00
R4010:Frmd6 UTSW 12 70899553 missense probably benign
R4416:Frmd6 UTSW 12 70877249 missense probably benign 0.04
R4823:Frmd6 UTSW 12 70872575 missense probably benign 0.22
R4861:Frmd6 UTSW 12 70893726 missense probably damaging 0.98
R5368:Frmd6 UTSW 12 70864100 nonsense probably null
R5806:Frmd6 UTSW 12 70890020 missense probably damaging 1.00
R6226:Frmd6 UTSW 12 70863911 start gained probably benign
R6253:Frmd6 UTSW 12 70877213 missense probably damaging 0.99
R7051:Frmd6 UTSW 12 70897396 missense possibly damaging 0.78
R7156:Frmd6 UTSW 12 70877209 missense probably damaging 1.00
R7481:Frmd6 UTSW 12 70887055 missense probably damaging 1.00
U24488:Frmd6 UTSW 12 70893879 missense probably damaging 0.97
X0022:Frmd6 UTSW 12 70864108 missense probably damaging 1.00
Z1088:Frmd6 UTSW 12 70880678 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCTTGACGACATCAGACTGTAC -3'
(R):5'- AAAGTGCAACTGTCCCAAGGC -3'

Sequencing Primer
(F):5'- TGTACCAGAAAGACTTCCTGCG -3'
(R):5'- GCAACTGTCCCAAGGCTTTTG -3'
Posted On2018-08-29