Incidental Mutation 'R6781:Gfra3'
ID531437
Institutional Source Beutler Lab
Gene Symbol Gfra3
Ensembl Gene ENSMUSG00000024366
Gene Nameglial cell line derived neurotrophic factor family receptor alpha 3
SynonymsGFRalpha3, GFR alpha-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.259) question?
Stock #R6781 (G1)
Quality Score218.009
Status Validated
Chromosome18
Chromosomal Location34689903-34720387 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34711322 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 55 (K55R)
Ref Sequence ENSEMBL: ENSMUSP00000025224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025224]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025224
AA Change: K55R

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000025224
Gene: ENSMUSG00000024366
AA Change: K55R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
GDNF 41 122 1.33e-15 SMART
GDNF 159 236 5.57e-18 SMART
GDNF 245 337 9.84e-28 SMART
low complexity region 380 393 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: This gene encodes a cell surface glycoprotein and member of the glial cell line-derived neurotrophic receptor (GDNFR) family of proteins. The encoded preproprotein is proteolytically processed to generate the mature protein. This protein mediates binding of the ligand artemin to the ret receptor tyrosine kinase, and this interaction may regulate thermal pain and axon regeneration. Homozygous knockout mice for this gene exhibit impaired proliferation of cultured neuroblasts and impaired development of the superior cervical ganglion. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for disruption of this gene display ptosis and poor development of the sympathetic chain ganglia and associated nerves. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,374,406 I259N possibly damaging Het
Acot12 G T 13: 91,784,412 probably null Het
AI182371 G T 2: 35,084,705 probably benign Het
Amigo3 T C 9: 108,053,963 L195P probably damaging Het
Aox4 A T 1: 58,245,109 D556V probably benign Het
Arhgef40 A C 14: 51,997,897 probably benign Het
Asb15 T C 6: 24,558,675 V63A probably benign Het
Bicd1 T C 6: 149,513,166 I459T possibly damaging Het
Bub1 C A 2: 127,807,857 G694W probably damaging Het
C4b A T 17: 34,742,954 I106N probably damaging Het
Clca4b T C 3: 144,922,801 I382V probably benign Het
Cntnap5a A C 1: 116,292,397 S646R probably benign Het
Cntnap5c C T 17: 58,138,653 Q563* probably null Het
Cpn1 A G 19: 43,980,904 F107L possibly damaging Het
Csrnp3 T A 2: 66,022,271 C336S probably benign Het
Defa3 T A 8: 21,288,261 M87K probably benign Het
Dmbt1 T C 7: 131,046,561 F274L probably benign Het
Dnah8 TTA TTATA 17: 30,765,724 probably null Het
Dnase2b T C 3: 146,582,371 H323R probably benign Het
Fam83e A T 7: 45,722,147 probably benign Het
Fbn1 T C 2: 125,317,038 N2269S probably damaging Het
Foxa1 A T 12: 57,543,257 M59K possibly damaging Het
Fpr3 T C 17: 17,970,716 V83A probably benign Het
Frmd6 A G 12: 70,899,643 D615G possibly damaging Het
Gm5414 A T 15: 101,625,661 S296T possibly damaging Het
Gtf3c1 T A 7: 125,659,197 K1234* probably null Het
Hltf T A 3: 20,098,166 Y609N probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ift74 A G 4: 94,627,302 D152G probably damaging Het
Kcnk6 T C 7: 29,225,055 Y308C probably damaging Het
Klhl29 A G 12: 5,091,347 S546P probably damaging Het
Map7d1 AGGGCAGCC AGGGCAGCCGGGCAGCC 4: 126,240,751 probably null Het
Meis2 T A 2: 116,049,155 H228L probably benign Het
Mfsd10 A T 5: 34,634,509 M344K possibly damaging Het
Mrps33 T C 6: 39,805,823 probably benign Het
Olfr1198 A T 2: 88,746,830 N19K probably benign Het
Olfr437 A G 6: 43,167,388 E110G probably damaging Het
Pik3cb T C 9: 99,040,992 T996A possibly damaging Het
Plekha7 A G 7: 116,157,855 probably null Het
Ppp1cb A G 5: 32,480,762 Y86C probably damaging Het
Sass6 T G 3: 116,595,124 probably benign Het
Slc6a15 A T 10: 103,395,067 I218F probably damaging Het
St5 T C 7: 109,525,304 D1110G possibly damaging Het
Tcf23 C T 5: 30,968,960 P61L probably benign Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zc3h6 T C 2: 129,015,421 F620S probably damaging Het
Other mutations in Gfra3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Gfra3 APN 18 34691548 critical splice donor site probably null
IGL01778:Gfra3 APN 18 34691591 missense possibly damaging 0.65
IGL02051:Gfra3 APN 18 34695841 missense possibly damaging 0.95
R0107:Gfra3 UTSW 18 34711306 missense probably benign 0.04
R0573:Gfra3 UTSW 18 34691615 missense probably benign
R1029:Gfra3 UTSW 18 34690839 missense probably benign 0.01
R1870:Gfra3 UTSW 18 34711320 missense probably damaging 0.97
R2512:Gfra3 UTSW 18 34704511 missense probably benign 0.04
R4689:Gfra3 UTSW 18 34690587 missense unknown
R4801:Gfra3 UTSW 18 34720192 missense probably damaging 0.98
R4802:Gfra3 UTSW 18 34720192 missense probably damaging 0.98
R4884:Gfra3 UTSW 18 34711251 missense probably benign 0.00
R5824:Gfra3 UTSW 18 34711211 missense probably damaging 1.00
R6111:Gfra3 UTSW 18 34690874 missense probably damaging 1.00
R6192:Gfra3 UTSW 18 34704529 missense possibly damaging 0.87
R6228:Gfra3 UTSW 18 34695793 missense probably damaging 1.00
R6251:Gfra3 UTSW 18 34695811 frame shift probably null
R6759:Gfra3 UTSW 18 34695873 nonsense probably null
R6894:Gfra3 UTSW 18 34695657 missense probably damaging 1.00
R7021:Gfra3 UTSW 18 34690880 missense probably benign 0.00
R7232:Gfra3 UTSW 18 34711181 missense probably damaging 1.00
R7236:Gfra3 UTSW 18 34695831 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCGTGATTCGCTGTAGGAC -3'
(R):5'- TCATGGTTTCATAGGGAATCTCC -3'

Sequencing Primer
(F):5'- GTGAACGGTCCAATAAATGTCC -3'
(R):5'- CCCTAACCTACCTCATGACTTAGTG -3'
Posted On2018-08-29