Incidental Mutation 'R6782:Arl5b'
ID531445
Institutional Source Beutler Lab
Gene Symbol Arl5b
Ensembl Gene ENSMUSG00000017418
Gene NameADP-ribosylation factor-like 5B
Synonyms4930587A11Rik, Arl8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R6782 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location15049395-15082456 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 15073182 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 106 (E106G)
Ref Sequence ENSEMBL: ENSMUSP00000069725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017562] [ENSMUST00000069870] [ENSMUST00000128682] [ENSMUST00000193836]
Predicted Effect possibly damaging
Transcript: ENSMUST00000017562
AA Change: E97G

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000017562
Gene: ENSMUSG00000017418
AA Change: E97G

DomainStartEndE-ValueType
ARF 4 171 4.8e-58 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000069870
AA Change: E106G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000069725
Gene: ENSMUSG00000017418
AA Change: E106G

DomainStartEndE-ValueType
ARF 2 180 3.95e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128682
Predicted Effect probably benign
Transcript: ENSMUST00000129509
Predicted Effect probably benign
Transcript: ENSMUST00000193836
Predicted Effect probably benign
Transcript: ENSMUST00000193883
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ARL5B (ARL8) belongs to a family of proteins that are structurally similar to ADP-ribosylation factors (ARFs; see MIM 103180). ARLs and ARFs are part of the RAS superfamily of regulatory GTPases.[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C T 7: 120,248,085 A724V probably damaging Het
Abcc3 A T 11: 94,358,950 F1055L probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Ankrd17 T C 5: 90,254,738 K1488R possibly damaging Het
Ano1 G A 7: 144,621,687 T498I probably damaging Het
Arhgap42 T A 9: 9,115,720 K118N probably damaging Het
Atp5g3 C T 2: 73,909,328 R56Q probably benign Het
Bbx T C 16: 50,200,565 R749G probably benign Het
Cacna1g A G 11: 94,459,550 S490P probably damaging Het
Ccdc63 A T 5: 122,111,014 Y417* probably null Het
Cep162 A T 9: 87,211,684 N880K probably benign Het
Chd2 G A 7: 73,475,379 Q77* probably null Het
Cntrl T G 2: 35,170,646 M1397R possibly damaging Het
Dcaf7 A G 11: 106,054,755 Y310C probably damaging Het
Dnah5 T A 15: 28,449,156 S4235T possibly damaging Het
Dot1l C T 10: 80,789,390 P1157L probably damaging Het
Esco2 T C 14: 65,820,016 T577A probably benign Het
Foxp1 T C 6: 98,930,145 D624G probably damaging Het
Gfi1 A T 5: 107,725,953 probably null Het
Gm10985 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 3: 53,845,205 probably null Het
Gm5113 G A 7: 30,178,753 V89I probably benign Het
Gtf3c2 A C 5: 31,169,836 L382R probably benign Het
Hhip T C 8: 80,051,604 N99S probably damaging Het
Hist1h3b T C 13: 23,752,410 S11P probably benign Het
Htr5b T C 1: 121,510,498 I335V probably benign Het
Ifi206 A G 1: 173,481,357 S358P unknown Het
Loxhd1 T A 18: 77,431,177 V1893D probably damaging Het
Mical2 A G 7: 112,346,761 R11G probably damaging Het
Mrc1 T C 2: 14,261,337 probably null Het
Npr1 T C 3: 90,456,253 N821S probably benign Het
Olfr1279 A G 2: 111,306,745 D180G probably damaging Het
Olfr487 T C 7: 108,212,463 D22G probably benign Het
Olfr495 T G 7: 108,395,537 M139R probably damaging Het
Olfr628 A G 7: 103,732,342 T139A possibly damaging Het
Pi4ka T A 16: 17,325,988 D739V probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Ptprd T C 4: 76,325,140 probably null Het
Ralgapb G A 2: 158,436,566 G5R probably damaging Het
Ric8b T C 10: 84,947,527 V83A probably damaging Het
Sdc2 C A 15: 33,028,135 T133K probably damaging Het
Slc12a7 T A 13: 73,798,969 V592D probably damaging Het
Sorcs1 G T 19: 50,176,122 Y990* probably null Het
Spata13 G T 14: 60,691,463 G157W probably damaging Het
Tada1 A G 1: 166,389,972 N226S probably benign Het
Tenm3 A G 8: 48,646,256 probably null Het
Tll1 A G 8: 64,071,281 V457A probably benign Het
Tmem232 T C 17: 65,500,124 K25E possibly damaging Het
Tnrc18 T C 5: 142,787,308 S406G unknown Het
Ush2a A G 1: 188,356,834 M329V probably benign Het
Vmn2r107 T C 17: 20,356,879 S380P probably damaging Het
Vmn2r73 A G 7: 85,870,355 M465T probably benign Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zfp217 T C 2: 170,116,258 D463G probably damaging Het
Zfp345 T C 2: 150,473,354 S88G probably damaging Het
Zfp975 A C 7: 42,662,030 N386K probably benign Het
Other mutations in Arl5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Arl5b APN 2 15069935 missense probably benign 0.03
IGL02374:Arl5b APN 2 15068192 missense probably damaging 1.00
IGL03213:Arl5b APN 2 15069865 missense probably damaging 1.00
IGL03396:Arl5b APN 2 15075104 missense probably damaging 0.96
R0559:Arl5b UTSW 2 15073187 missense probably damaging 1.00
R0959:Arl5b UTSW 2 15073131 missense probably damaging 1.00
R1160:Arl5b UTSW 2 15069837 missense probably benign 0.36
R1766:Arl5b UTSW 2 15069837 missense probably benign 0.36
R2100:Arl5b UTSW 2 15073195 missense probably benign 0.03
R2403:Arl5b UTSW 2 15075037 missense probably damaging 1.00
R4272:Arl5b UTSW 2 15073179 missense probably damaging 1.00
R7423:Arl5b UTSW 2 15068172 missense probably damaging 1.00
R7898:Arl5b UTSW 2 15075058 missense probably damaging 0.99
R7981:Arl5b UTSW 2 15075058 missense probably damaging 0.99
Z1088:Arl5b UTSW 2 15075021 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TACGTGCTCGCTGATGGAAAG -3'
(R):5'- GTTGTAGCAAGCAAATTAACAGGC -3'

Sequencing Primer
(F):5'- AAGGCAGTGAGGTTCTGTAGC -3'
(R):5'- CAAGCAAATTAACAGGCTTGAAG -3'
Posted On2018-08-29