Incidental Mutation 'R6782:Olfr628'
ID 531465
Institutional Source Beutler Lab
Gene Symbol Olfr628
Ensembl Gene ENSMUSG00000096516
Gene Name olfactory receptor 628
Synonyms GA_x6K02T2PBJ9-6457667-6458617, MOR22-4P, MOR22-4P, Olfr1526-ps1, MOR22-1
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R6782 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 103730374-103733324 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 103732342 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 139 (T139A)
Ref Sequence ENSEMBL: ENSMUSP00000151622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098193] [ENSMUST00000218266]
AlphaFold K7N6B2
Predicted Effect possibly damaging
Transcript: ENSMUST00000098193
AA Change: T139A

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000095795
Gene: ENSMUSG00000096516
AA Change: T139A

DomainStartEndE-ValueType
Pfam:7tm_4 33 313 2.3e-106 PFAM
Pfam:7tm_1 43 295 1.5e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000218266
AA Change: T139A

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C T 7: 120,248,085 A724V probably damaging Het
Abcc3 A T 11: 94,358,950 F1055L probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Ankrd17 T C 5: 90,254,738 K1488R possibly damaging Het
Ano1 G A 7: 144,621,687 T498I probably damaging Het
Arhgap42 T A 9: 9,115,720 K118N probably damaging Het
Arl5b A G 2: 15,073,182 E106G probably damaging Het
Atp5g3 C T 2: 73,909,328 R56Q probably benign Het
Bbx T C 16: 50,200,565 R749G probably benign Het
Cacna1g A G 11: 94,459,550 S490P probably damaging Het
Ccdc63 A T 5: 122,111,014 Y417* probably null Het
Cep162 A T 9: 87,211,684 N880K probably benign Het
Chd2 G A 7: 73,475,379 Q77* probably null Het
Cntrl T G 2: 35,170,646 M1397R possibly damaging Het
Dcaf7 A G 11: 106,054,755 Y310C probably damaging Het
Dnah5 T A 15: 28,449,156 S4235T possibly damaging Het
Dot1l C T 10: 80,789,390 P1157L probably damaging Het
Esco2 T C 14: 65,820,016 T577A probably benign Het
Foxp1 T C 6: 98,930,145 D624G probably damaging Het
Gfi1 A T 5: 107,725,953 probably null Het
Gm10985 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 3: 53,845,205 probably null Het
Gm5113 G A 7: 30,178,753 V89I probably benign Het
Gtf3c2 A C 5: 31,169,836 L382R probably benign Het
Hhip T C 8: 80,051,604 N99S probably damaging Het
Hist1h3b T C 13: 23,752,410 S11P probably benign Het
Htr5b T C 1: 121,510,498 I335V probably benign Het
Ifi206 A G 1: 173,481,357 S358P unknown Het
Loxhd1 T A 18: 77,431,177 V1893D probably damaging Het
Mical2 A G 7: 112,346,761 R11G probably damaging Het
Mrc1 T C 2: 14,261,337 probably null Het
Npr1 T C 3: 90,456,253 N821S probably benign Het
Olfr1279 A G 2: 111,306,745 D180G probably damaging Het
Olfr487 T C 7: 108,212,463 D22G probably benign Het
Olfr495 T G 7: 108,395,537 M139R probably damaging Het
Pi4ka T A 16: 17,325,988 D739V probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Ptprd T C 4: 76,325,140 probably null Het
Ralgapb G A 2: 158,436,566 G5R probably damaging Het
Ric8b T C 10: 84,947,527 V83A probably damaging Het
Sdc2 C A 15: 33,028,135 T133K probably damaging Het
Slc12a7 T A 13: 73,798,969 V592D probably damaging Het
Sorcs1 G T 19: 50,176,122 Y990* probably null Het
Spata13 G T 14: 60,691,463 G157W probably damaging Het
Tada1 A G 1: 166,389,972 N226S probably benign Het
Tenm3 A G 8: 48,646,256 probably null Het
Tll1 A G 8: 64,071,281 V457A probably benign Het
Tmem232 T C 17: 65,500,124 K25E possibly damaging Het
Tnrc18 T C 5: 142,787,308 S406G unknown Het
Ush2a A G 1: 188,356,834 M329V probably benign Het
Vmn2r107 T C 17: 20,356,879 S380P probably damaging Het
Vmn2r73 A G 7: 85,870,355 M465T probably benign Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zfp217 T C 2: 170,116,258 D463G probably damaging Het
Zfp345 T C 2: 150,473,354 S88G probably damaging Het
Zfp975 A C 7: 42,662,030 N386K probably benign Het
Other mutations in Olfr628
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01892:Olfr628 APN 7 103732480 missense possibly damaging 0.47
IGL02121:Olfr628 APN 7 103732469 missense probably damaging 1.00
R0140:Olfr628 UTSW 7 103732142 missense probably damaging 1.00
R0505:Olfr628 UTSW 7 103732376 missense probably benign 0.09
R0582:Olfr628 UTSW 7 103732673 missense possibly damaging 0.82
R1585:Olfr628 UTSW 7 103732378 missense possibly damaging 0.56
R1907:Olfr628 UTSW 7 103731983 missense probably damaging 1.00
R4766:Olfr628 UTSW 7 103732250 missense possibly damaging 0.70
R4954:Olfr628 UTSW 7 103732207 missense probably damaging 1.00
R5464:Olfr628 UTSW 7 103732189 missense probably damaging 1.00
R6737:Olfr628 UTSW 7 103732150 missense probably damaging 1.00
R6761:Olfr628 UTSW 7 103732484 missense probably damaging 1.00
R7015:Olfr628 UTSW 7 103732817 missense probably null 0.85
R7503:Olfr628 UTSW 7 103732267 missense probably damaging 1.00
R7959:Olfr628 UTSW 7 103732808 missense probably damaging 1.00
R8347:Olfr628 UTSW 7 103731943 missense probably benign
R8984:Olfr628 UTSW 7 103732013 missense probably damaging 0.99
R9000:Olfr628 UTSW 7 103732465 missense probably damaging 0.99
R9204:Olfr628 UTSW 7 103732849 missense possibly damaging 0.72
X0058:Olfr628 UTSW 7 103732282 missense probably damaging 1.00
Z1176:Olfr628 UTSW 7 103732781 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTCTAGCAATGCTTGGAGC -3'
(R):5'- CATGAACATCTTCTGCTGCC -3'

Sequencing Primer
(F):5'- GCTTGGAGCAACAGATATTTCTC -3'
(R):5'- TGCTGCCAGCTTCACAATGG -3'
Posted On 2018-08-29