Incidental Mutation 'R6782:Ric8b'
ID531478
Institutional Source Beutler Lab
Gene Symbol Ric8b
Ensembl Gene ENSMUSG00000035620
Gene NameRIC8 guanine nucleotide exchange factor B
SynonymsRic-8b, Ric-8
MMRRC Submission
Accession Numbers

Genbank: NM_001013441, NM_183172; MGI: 2682307

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6782 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location84917616-85018337 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84947527 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 83 (V83A)
Ref Sequence ENSEMBL: ENSMUSP00000093032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038523] [ENSMUST00000095385] [ENSMUST00000214693]
Predicted Effect probably damaging
Transcript: ENSMUST00000038523
AA Change: V83A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046981
Gene: ENSMUSG00000035620
AA Change: V83A

DomainStartEndE-ValueType
Pfam:Ric8 66 538 8.1e-125 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000095385
AA Change: V83A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093032
Gene: ENSMUSG00000035620
AA Change: V83A

DomainStartEndE-ValueType
Pfam:Ric8 66 486 1.2e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214693
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI

All alleles(24) : Targeted, other(4) Gene trapped(20)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C T 7: 120,248,085 A724V probably damaging Het
Abcc3 A T 11: 94,358,950 F1055L probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Ankrd17 T C 5: 90,254,738 K1488R possibly damaging Het
Ano1 G A 7: 144,621,687 T498I probably damaging Het
Arhgap42 T A 9: 9,115,720 K118N probably damaging Het
Arl5b A G 2: 15,073,182 E106G probably damaging Het
Atp5g3 C T 2: 73,909,328 R56Q probably benign Het
Bbx T C 16: 50,200,565 R749G probably benign Het
Cacna1g A G 11: 94,459,550 S490P probably damaging Het
Ccdc63 A T 5: 122,111,014 Y417* probably null Het
Cep162 A T 9: 87,211,684 N880K probably benign Het
Chd2 G A 7: 73,475,379 Q77* probably null Het
Cntrl T G 2: 35,170,646 M1397R possibly damaging Het
Dcaf7 A G 11: 106,054,755 Y310C probably damaging Het
Dnah5 T A 15: 28,449,156 S4235T possibly damaging Het
Dot1l C T 10: 80,789,390 P1157L probably damaging Het
Esco2 T C 14: 65,820,016 T577A probably benign Het
Foxp1 T C 6: 98,930,145 D624G probably damaging Het
Gfi1 A T 5: 107,725,953 probably null Het
Gm10985 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 3: 53,845,205 probably null Het
Gm5113 G A 7: 30,178,753 V89I probably benign Het
Gtf3c2 A C 5: 31,169,836 L382R probably benign Het
Hhip T C 8: 80,051,604 N99S probably damaging Het
Hist1h3b T C 13: 23,752,410 S11P probably benign Het
Htr5b T C 1: 121,510,498 I335V probably benign Het
Ifi206 A G 1: 173,481,357 S358P unknown Het
Loxhd1 T A 18: 77,431,177 V1893D probably damaging Het
Mical2 A G 7: 112,346,761 R11G probably damaging Het
Mrc1 T C 2: 14,261,337 probably null Het
Npr1 T C 3: 90,456,253 N821S probably benign Het
Olfr1279 A G 2: 111,306,745 D180G probably damaging Het
Olfr487 T C 7: 108,212,463 D22G probably benign Het
Olfr495 T G 7: 108,395,537 M139R probably damaging Het
Olfr628 A G 7: 103,732,342 T139A possibly damaging Het
Pi4ka T A 16: 17,325,988 D739V probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Ptprd T C 4: 76,325,140 probably null Het
Ralgapb G A 2: 158,436,566 G5R probably damaging Het
Sdc2 C A 15: 33,028,135 T133K probably damaging Het
Slc12a7 T A 13: 73,798,969 V592D probably damaging Het
Sorcs1 G T 19: 50,176,122 Y990* probably null Het
Spata13 G T 14: 60,691,463 G157W probably damaging Het
Tada1 A G 1: 166,389,972 N226S probably benign Het
Tenm3 A G 8: 48,646,256 probably null Het
Tll1 A G 8: 64,071,281 V457A probably benign Het
Tmem232 T C 17: 65,500,124 K25E possibly damaging Het
Tnrc18 T C 5: 142,787,308 S406G unknown Het
Ush2a A G 1: 188,356,834 M329V probably benign Het
Vmn2r107 T C 17: 20,356,879 S380P probably damaging Het
Vmn2r73 A G 7: 85,870,355 M465T probably benign Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zfp217 T C 2: 170,116,258 D463G probably damaging Het
Zfp345 T C 2: 150,473,354 S88G probably damaging Het
Zfp975 A C 7: 42,662,030 N386K probably benign Het
Other mutations in Ric8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02254:Ric8b APN 10 84980136 missense probably damaging 1.00
IGL02388:Ric8b APN 10 84992271 unclassified probably benign
IGL02435:Ric8b APN 10 84980076 missense probably benign 0.06
IGL02890:Ric8b APN 10 85001867 missense possibly damaging 0.80
IGL03163:Ric8b APN 10 85001822 missense probably damaging 1.00
IGL03211:Ric8b APN 10 85001793 missense probably damaging 1.00
D4216:Ric8b UTSW 10 85015141 missense probably damaging 0.99
R0491:Ric8b UTSW 10 84992222 missense probably damaging 1.00
R0612:Ric8b UTSW 10 85001881 missense probably damaging 1.00
R1077:Ric8b UTSW 10 84970717 splice site probably benign
R1448:Ric8b UTSW 10 84947671 missense possibly damaging 0.93
R1565:Ric8b UTSW 10 84980099 missense probably benign 0.01
R1617:Ric8b UTSW 10 84947611 missense probably damaging 0.98
R1634:Ric8b UTSW 10 84970748 missense probably damaging 1.00
R1983:Ric8b UTSW 10 85001838 missense probably damaging 0.99
R2339:Ric8b UTSW 10 84970024 missense probably benign 0.00
R2897:Ric8b UTSW 10 84947897 missense probably benign 0.01
R2898:Ric8b UTSW 10 84947897 missense probably benign 0.01
R4657:Ric8b UTSW 10 84992137 missense probably damaging 1.00
R4747:Ric8b UTSW 10 84917764 missense probably benign 0.36
R4953:Ric8b UTSW 10 84958082 missense possibly damaging 0.92
R5277:Ric8b UTSW 10 84947652 missense probably damaging 0.99
R5308:Ric8b UTSW 10 84947747 missense probably benign
R5326:Ric8b UTSW 10 84992212 missense probably damaging 1.00
R6248:Ric8b UTSW 10 84947845 missense probably damaging 1.00
R7548:Ric8b UTSW 10 84947872 missense probably damaging 1.00
R8123:Ric8b UTSW 10 84969873 missense probably damaging 1.00
Z1176:Ric8b UTSW 10 84947544 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GCCATATCTTTAGCCTGCATTGG -3'
(R):5'- TAGGAGGTTACAGAGCTTTGC -3'

Sequencing Primer
(F):5'- GCCTGCATTGGTAGAAAATACTC -3'
(R):5'- TGCAGCGAGATTCAGTTCCAG -3'
Posted On2018-08-29