Incidental Mutation 'R6782:Dcaf7'
ID531481
Institutional Source Beutler Lab
Gene Symbol Dcaf7
Ensembl Gene ENSMUSG00000049354
Gene NameDDB1 and CUL4 associated factor 7
Synonyms1700012F10Rik, 2610037L01Rik, Wdr68
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6782 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location106036872-106059324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106054755 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 310 (Y310C)
Ref Sequence ENSEMBL: ENSMUSP00000058168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058438]
Predicted Effect probably damaging
Transcript: ENSMUST00000058438
AA Change: Y310C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058168
Gene: ENSMUSG00000049354
AA Change: Y310C

DomainStartEndE-ValueType
WD40 58 99 3.42e1 SMART
WD40 104 149 1.43e1 SMART
WD40 163 205 3.81e-5 SMART
WD40 211 251 1.1e2 SMART
WD40 255 295 8.88e-6 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with multiple WD40 repeats which facilitate protein-protein interactions and thereby enable the assembly of multiprotein complexes. This protein has been shown to function as a scaffold protein for protein complexes involved in kinase signaling. This highly conserved gene is present in eukaryotic plants, fungi, and animals. The ortholog of this gene was first identified in plants as a key regulator of anthocyanin biosynthesis and flower pigmentation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C T 7: 120,248,085 A724V probably damaging Het
Abcc3 A T 11: 94,358,950 F1055L probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Ankrd17 T C 5: 90,254,738 K1488R possibly damaging Het
Ano1 G A 7: 144,621,687 T498I probably damaging Het
Arhgap42 T A 9: 9,115,720 K118N probably damaging Het
Arl5b A G 2: 15,073,182 E106G probably damaging Het
Atp5g3 C T 2: 73,909,328 R56Q probably benign Het
Bbx T C 16: 50,200,565 R749G probably benign Het
Cacna1g A G 11: 94,459,550 S490P probably damaging Het
Ccdc63 A T 5: 122,111,014 Y417* probably null Het
Cep162 A T 9: 87,211,684 N880K probably benign Het
Chd2 G A 7: 73,475,379 Q77* probably null Het
Cntrl T G 2: 35,170,646 M1397R possibly damaging Het
Dnah5 T A 15: 28,449,156 S4235T possibly damaging Het
Dot1l C T 10: 80,789,390 P1157L probably damaging Het
Esco2 T C 14: 65,820,016 T577A probably benign Het
Foxp1 T C 6: 98,930,145 D624G probably damaging Het
Gfi1 A T 5: 107,725,953 probably null Het
Gm10985 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 3: 53,845,205 probably null Het
Gm5113 G A 7: 30,178,753 V89I probably benign Het
Gtf3c2 A C 5: 31,169,836 L382R probably benign Het
Hhip T C 8: 80,051,604 N99S probably damaging Het
Hist1h3b T C 13: 23,752,410 S11P probably benign Het
Htr5b T C 1: 121,510,498 I335V probably benign Het
Ifi206 A G 1: 173,481,357 S358P unknown Het
Loxhd1 T A 18: 77,431,177 V1893D probably damaging Het
Mical2 A G 7: 112,346,761 R11G probably damaging Het
Mrc1 T C 2: 14,261,337 probably null Het
Npr1 T C 3: 90,456,253 N821S probably benign Het
Olfr1279 A G 2: 111,306,745 D180G probably damaging Het
Olfr487 T C 7: 108,212,463 D22G probably benign Het
Olfr495 T G 7: 108,395,537 M139R probably damaging Het
Olfr628 A G 7: 103,732,342 T139A possibly damaging Het
Pi4ka T A 16: 17,325,988 D739V probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Ptprd T C 4: 76,325,140 probably null Het
Ralgapb G A 2: 158,436,566 G5R probably damaging Het
Ric8b T C 10: 84,947,527 V83A probably damaging Het
Sdc2 C A 15: 33,028,135 T133K probably damaging Het
Slc12a7 T A 13: 73,798,969 V592D probably damaging Het
Sorcs1 G T 19: 50,176,122 Y990* probably null Het
Spata13 G T 14: 60,691,463 G157W probably damaging Het
Tada1 A G 1: 166,389,972 N226S probably benign Het
Tenm3 A G 8: 48,646,256 probably null Het
Tll1 A G 8: 64,071,281 V457A probably benign Het
Tmem232 T C 17: 65,500,124 K25E possibly damaging Het
Tnrc18 T C 5: 142,787,308 S406G unknown Het
Ush2a A G 1: 188,356,834 M329V probably benign Het
Vmn2r107 T C 17: 20,356,879 S380P probably damaging Het
Vmn2r73 A G 7: 85,870,355 M465T probably benign Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zfp217 T C 2: 170,116,258 D463G probably damaging Het
Zfp345 T C 2: 150,473,354 S88G probably damaging Het
Zfp975 A C 7: 42,662,030 N386K probably benign Het
Other mutations in Dcaf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Dcaf7 APN 11 106054746 missense probably damaging 1.00
IGL01584:Dcaf7 APN 11 106053827 missense probably benign 0.12
IGL02398:Dcaf7 APN 11 106053753 missense probably benign 0.03
IGL02516:Dcaf7 APN 11 106051872 missense probably damaging 1.00
IGL02672:Dcaf7 APN 11 106054858 utr 3 prime probably benign
IGL02892:Dcaf7 APN 11 106046692 missense possibly damaging 0.95
IGL02953:Dcaf7 APN 11 106051876 nonsense probably null
R0179:Dcaf7 UTSW 11 106051797 missense probably damaging 0.98
R0539:Dcaf7 UTSW 11 106051826 missense probably damaging 0.98
R1471:Dcaf7 UTSW 11 106046747 missense probably benign 0.01
R1647:Dcaf7 UTSW 11 106051802 missense probably damaging 1.00
R1648:Dcaf7 UTSW 11 106051802 missense probably damaging 1.00
R3551:Dcaf7 UTSW 11 106054796 missense probably benign 0.00
R4656:Dcaf7 UTSW 11 106053798 missense probably damaging 1.00
R6167:Dcaf7 UTSW 11 106037251 missense probably damaging 0.99
R6192:Dcaf7 UTSW 11 106051758 missense probably damaging 1.00
R6864:Dcaf7 UTSW 11 106046821 missense probably damaging 1.00
R7155:Dcaf7 UTSW 11 106037190 missense probably damaging 0.97
R7253:Dcaf7 UTSW 11 106047843 intron probably null
R7446:Dcaf7 UTSW 11 106053735 missense probably benign 0.04
R7631:Dcaf7 UTSW 11 106053753 missense probably benign 0.03
Z1177:Dcaf7 UTSW 11 106053795 missense not run
Predicted Primers PCR Primer
(F):5'- CCCTTTCACAAAGCTTTGATGAAC -3'
(R):5'- TTCTACAGCAGCTTCTGAACAC -3'

Sequencing Primer
(F):5'- AGCTTTGATGAACAAATGTTTCAC -3'
(R):5'- ATACTGGCCACTGGGAACATGTTC -3'
Posted On2018-08-29