Incidental Mutation 'R6782:Slc12a7'
ID 531483
Institutional Source Beutler Lab
Gene Symbol Slc12a7
Ensembl Gene ENSMUSG00000017756
Gene Name solute carrier family 12, member 7
Synonyms Kcc4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6782 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 73733094-73816754 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 73798969 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 592 (V592D)
Ref Sequence ENSEMBL: ENSMUSP00000017900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017900]
AlphaFold Q9WVL3
Predicted Effect probably damaging
Transcript: ENSMUST00000017900
AA Change: V592D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000017900
Gene: ENSMUSG00000017756
AA Change: V592D

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 99 113 N/A INTRINSIC
Pfam:AA_permease 123 308 1e-22 PFAM
low complexity region 390 407 N/A INTRINSIC
Pfam:AA_permease 410 696 1.5e-40 PFAM
Pfam:SLC12 708 834 4.6e-18 PFAM
Pfam:SLC12 818 1083 2.3e-32 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Hearing is severely impaired in homozygous mutant mice, which also exhibit renal tubular acidosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C T 7: 120,248,085 A724V probably damaging Het
Abcc3 A T 11: 94,358,950 F1055L probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Ankrd17 T C 5: 90,254,738 K1488R possibly damaging Het
Ano1 G A 7: 144,621,687 T498I probably damaging Het
Arhgap42 T A 9: 9,115,720 K118N probably damaging Het
Arl5b A G 2: 15,073,182 E106G probably damaging Het
Atp5g3 C T 2: 73,909,328 R56Q probably benign Het
Bbx T C 16: 50,200,565 R749G probably benign Het
Cacna1g A G 11: 94,459,550 S490P probably damaging Het
Ccdc63 A T 5: 122,111,014 Y417* probably null Het
Cep162 A T 9: 87,211,684 N880K probably benign Het
Chd2 G A 7: 73,475,379 Q77* probably null Het
Cntrl T G 2: 35,170,646 M1397R possibly damaging Het
Dcaf7 A G 11: 106,054,755 Y310C probably damaging Het
Dnah5 T A 15: 28,449,156 S4235T possibly damaging Het
Dot1l C T 10: 80,789,390 P1157L probably damaging Het
Esco2 T C 14: 65,820,016 T577A probably benign Het
Foxp1 T C 6: 98,930,145 D624G probably damaging Het
Gfi1 A T 5: 107,725,953 probably null Het
Gm10985 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 3: 53,845,205 probably null Het
Gm5113 G A 7: 30,178,753 V89I probably benign Het
Gtf3c2 A C 5: 31,169,836 L382R probably benign Het
Hhip T C 8: 80,051,604 N99S probably damaging Het
Hist1h3b T C 13: 23,752,410 S11P probably benign Het
Htr5b T C 1: 121,510,498 I335V probably benign Het
Ifi206 A G 1: 173,481,357 S358P unknown Het
Loxhd1 T A 18: 77,431,177 V1893D probably damaging Het
Mical2 A G 7: 112,346,761 R11G probably damaging Het
Mrc1 T C 2: 14,261,337 probably null Het
Npr1 T C 3: 90,456,253 N821S probably benign Het
Olfr1279 A G 2: 111,306,745 D180G probably damaging Het
Olfr487 T C 7: 108,212,463 D22G probably benign Het
Olfr495 T G 7: 108,395,537 M139R probably damaging Het
Olfr628 A G 7: 103,732,342 T139A possibly damaging Het
Pi4ka T A 16: 17,325,988 D739V probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Ptprd T C 4: 76,325,140 probably null Het
Ralgapb G A 2: 158,436,566 G5R probably damaging Het
Ric8b T C 10: 84,947,527 V83A probably damaging Het
Sdc2 C A 15: 33,028,135 T133K probably damaging Het
Sorcs1 G T 19: 50,176,122 Y990* probably null Het
Spata13 G T 14: 60,691,463 G157W probably damaging Het
Tada1 A G 1: 166,389,972 N226S probably benign Het
Tenm3 A G 8: 48,646,256 probably null Het
Tll1 A G 8: 64,071,281 V457A probably benign Het
Tmem232 T C 17: 65,500,124 K25E possibly damaging Het
Tnrc18 T C 5: 142,787,308 S406G unknown Het
Ush2a A G 1: 188,356,834 M329V probably benign Het
Vmn2r107 T C 17: 20,356,879 S380P probably damaging Het
Vmn2r73 A G 7: 85,870,355 M465T probably benign Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zfp217 T C 2: 170,116,258 D463G probably damaging Het
Zfp345 T C 2: 150,473,354 S88G probably damaging Het
Zfp975 A C 7: 42,662,030 N386K probably benign Het
Other mutations in Slc12a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Slc12a7 APN 13 73794082 missense possibly damaging 0.77
IGL01086:Slc12a7 APN 13 73814843 missense probably damaging 1.00
IGL01344:Slc12a7 APN 13 73792737 missense probably damaging 1.00
IGL01739:Slc12a7 APN 13 73799614 missense probably benign 0.00
IGL02039:Slc12a7 APN 13 73809094 critical splice donor site probably null
IGL02213:Slc12a7 APN 13 73797703 critical splice donor site probably null
IGL02285:Slc12a7 APN 13 73795595 unclassified probably benign
IGL02422:Slc12a7 APN 13 73806161 missense probably benign 0.18
IGL02423:Slc12a7 APN 13 73763763 utr 5 prime probably benign
IGL02596:Slc12a7 APN 13 73785123 missense probably benign 0.01
IGL02794:Slc12a7 APN 13 73809087 missense possibly damaging 0.68
IGL02813:Slc12a7 APN 13 73813676 unclassified probably benign
IGL02868:Slc12a7 APN 13 73806388 missense probably benign
R0828:Slc12a7 UTSW 13 73788652 missense probably benign 0.03
R1440:Slc12a7 UTSW 13 73801008 missense probably damaging 1.00
R1659:Slc12a7 UTSW 13 73790671 missense probably damaging 1.00
R1669:Slc12a7 UTSW 13 73795113 missense probably benign 0.00
R2111:Slc12a7 UTSW 13 73785155 nonsense probably null
R3023:Slc12a7 UTSW 13 73800422 missense probably benign 0.07
R3612:Slc12a7 UTSW 13 73809923 missense probably benign 0.30
R4210:Slc12a7 UTSW 13 73814843 missense probably damaging 1.00
R4353:Slc12a7 UTSW 13 73790734 missense possibly damaging 0.63
R4761:Slc12a7 UTSW 13 73813589 missense probably benign 0.06
R4801:Slc12a7 UTSW 13 73763892 critical splice donor site probably null
R4802:Slc12a7 UTSW 13 73763892 critical splice donor site probably null
R5002:Slc12a7 UTSW 13 73763777 missense possibly damaging 0.66
R5128:Slc12a7 UTSW 13 73805433 missense probably benign 0.03
R5594:Slc12a7 UTSW 13 73785139 missense probably benign
R5760:Slc12a7 UTSW 13 73813622 missense probably damaging 1.00
R5854:Slc12a7 UTSW 13 73793940 missense probably benign 0.03
R6233:Slc12a7 UTSW 13 73805471 missense possibly damaging 0.63
R6693:Slc12a7 UTSW 13 73797537 missense probably benign 0.00
R7169:Slc12a7 UTSW 13 73784560 missense probably benign 0.30
R7225:Slc12a7 UTSW 13 73763962 intron probably benign
R7458:Slc12a7 UTSW 13 73785069 missense probably damaging 1.00
R7534:Slc12a7 UTSW 13 73764068 intron probably benign
R7565:Slc12a7 UTSW 13 73790772 missense possibly damaging 0.58
R7660:Slc12a7 UTSW 13 73806089 missense probably benign
R7737:Slc12a7 UTSW 13 73788677 missense probably benign 0.01
R7783:Slc12a7 UTSW 13 73805469 missense probably benign 0.44
R7875:Slc12a7 UTSW 13 73788604 missense possibly damaging 0.94
R8017:Slc12a7 UTSW 13 73799720 missense probably damaging 1.00
R8019:Slc12a7 UTSW 13 73799720 missense probably damaging 1.00
R8281:Slc12a7 UTSW 13 73790677 missense probably damaging 1.00
R8342:Slc12a7 UTSW 13 73785162 missense probably benign
R8747:Slc12a7 UTSW 13 73785122 missense probably benign 0.30
R8920:Slc12a7 UTSW 13 73798449 missense probably damaging 1.00
R9292:Slc12a7 UTSW 13 73784588 missense possibly damaging 0.46
R9381:Slc12a7 UTSW 13 73800944 missense probably benign 0.00
R9400:Slc12a7 UTSW 13 73784570 missense probably benign 0.00
X0023:Slc12a7 UTSW 13 73788608 missense possibly damaging 0.94
X0028:Slc12a7 UTSW 13 73798541 splice site probably null
X0065:Slc12a7 UTSW 13 73800945 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCATGCGACTTATTCTTAGGGTC -3'
(R):5'- TGGCCTCCTAGACTTCACTG -3'

Sequencing Primer
(F):5'- TCCCTCAGCTGCTGTGTAGAG -3'
(R):5'- TGGGTCTCCTTCCACCAAAACAG -3'
Posted On 2018-08-29