Incidental Mutation 'R6782:Vmn2r107'
ID531491
Institutional Source Beutler Lab
Gene Symbol Vmn2r107
Ensembl Gene ENSMUSG00000056910
Gene Namevomeronasal 2, receptor 107
SynonymsV2r6
MMRRC Submission
Accession Numbers

Genbank: NM_001104569; MGI: 1316664

Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R6782 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location20345425-20375772 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20356879 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 380 (S380P)
Ref Sequence ENSEMBL: ENSMUSP00000048706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042090]
Predicted Effect probably damaging
Transcript: ENSMUST00000042090
AA Change: S380P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048706
Gene: ENSMUSG00000056910
AA Change: S380P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 466 3.6e-40 PFAM
Pfam:NCD3G 509 562 5.1e-21 PFAM
Pfam:7tm_3 593 830 8e-51 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C T 7: 120,248,085 A724V probably damaging Het
Abcc3 A T 11: 94,358,950 F1055L probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Ankrd17 T C 5: 90,254,738 K1488R possibly damaging Het
Ano1 G A 7: 144,621,687 T498I probably damaging Het
Arhgap42 T A 9: 9,115,720 K118N probably damaging Het
Arl5b A G 2: 15,073,182 E106G probably damaging Het
Atp5g3 C T 2: 73,909,328 R56Q probably benign Het
Bbx T C 16: 50,200,565 R749G probably benign Het
Cacna1g A G 11: 94,459,550 S490P probably damaging Het
Ccdc63 A T 5: 122,111,014 Y417* probably null Het
Cep162 A T 9: 87,211,684 N880K probably benign Het
Chd2 G A 7: 73,475,379 Q77* probably null Het
Cntrl T G 2: 35,170,646 M1397R possibly damaging Het
Dcaf7 A G 11: 106,054,755 Y310C probably damaging Het
Dnah5 T A 15: 28,449,156 S4235T possibly damaging Het
Dot1l C T 10: 80,789,390 P1157L probably damaging Het
Esco2 T C 14: 65,820,016 T577A probably benign Het
Foxp1 T C 6: 98,930,145 D624G probably damaging Het
Gfi1 A T 5: 107,725,953 probably null Het
Gm10985 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 3: 53,845,205 probably null Het
Gm5113 G A 7: 30,178,753 V89I probably benign Het
Gtf3c2 A C 5: 31,169,836 L382R probably benign Het
Hhip T C 8: 80,051,604 N99S probably damaging Het
Hist1h3b T C 13: 23,752,410 S11P probably benign Het
Htr5b T C 1: 121,510,498 I335V probably benign Het
Ifi206 A G 1: 173,481,357 S358P unknown Het
Loxhd1 T A 18: 77,431,177 V1893D probably damaging Het
Mical2 A G 7: 112,346,761 R11G probably damaging Het
Mrc1 T C 2: 14,261,337 probably null Het
Npr1 T C 3: 90,456,253 N821S probably benign Het
Olfr1279 A G 2: 111,306,745 D180G probably damaging Het
Olfr487 T C 7: 108,212,463 D22G probably benign Het
Olfr495 T G 7: 108,395,537 M139R probably damaging Het
Olfr628 A G 7: 103,732,342 T139A possibly damaging Het
Pi4ka T A 16: 17,325,988 D739V probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Ptprd T C 4: 76,325,140 probably null Het
Ralgapb G A 2: 158,436,566 G5R probably damaging Het
Ric8b T C 10: 84,947,527 V83A probably damaging Het
Sdc2 C A 15: 33,028,135 T133K probably damaging Het
Slc12a7 T A 13: 73,798,969 V592D probably damaging Het
Sorcs1 G T 19: 50,176,122 Y990* probably null Het
Spata13 G T 14: 60,691,463 G157W probably damaging Het
Tada1 A G 1: 166,389,972 N226S probably benign Het
Tenm3 A G 8: 48,646,256 probably null Het
Tll1 A G 8: 64,071,281 V457A probably benign Het
Tmem232 T C 17: 65,500,124 K25E possibly damaging Het
Tnrc18 T C 5: 142,787,308 S406G unknown Het
Ush2a A G 1: 188,356,834 M329V probably benign Het
Vmn2r73 A G 7: 85,870,355 M465T probably benign Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zfp217 T C 2: 170,116,258 D463G probably damaging Het
Zfp345 T C 2: 150,473,354 S88G probably damaging Het
Zfp975 A C 7: 42,662,030 N386K probably benign Het
Other mutations in Vmn2r107
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Vmn2r107 APN 17 20375747 missense probably damaging 0.98
IGL01768:Vmn2r107 APN 17 20345606 missense probably benign 0.32
IGL02086:Vmn2r107 APN 17 20357800 missense probably benign 0.00
IGL02136:Vmn2r107 APN 17 20374906 missense probably benign 0.02
IGL02266:Vmn2r107 APN 17 20356777 missense probably damaging 1.00
IGL02285:Vmn2r107 APN 17 20375561 missense probably damaging 1.00
IGL02724:Vmn2r107 APN 17 20356744 missense possibly damaging 0.49
IGL02998:Vmn2r107 APN 17 20357755 missense probably damaging 0.99
IGL03089:Vmn2r107 APN 17 20375712 missense probably benign 0.05
IGL03284:Vmn2r107 APN 17 20356911 missense probably benign 0.07
IGL03307:Vmn2r107 APN 17 20356776 missense probably benign 0.09
IGL03399:Vmn2r107 APN 17 20357958 splice site probably benign
3-1:Vmn2r107 UTSW 17 20345504 missense probably benign
BB006:Vmn2r107 UTSW 17 20345444 missense probably null 0.96
BB016:Vmn2r107 UTSW 17 20345444 missense probably null 0.96
R0285:Vmn2r107 UTSW 17 20345611 missense probably benign 0.00
R0455:Vmn2r107 UTSW 17 20374823 splice site probably benign
R0497:Vmn2r107 UTSW 17 20375132 missense probably damaging 1.00
R0506:Vmn2r107 UTSW 17 20357759 missense probably benign
R0621:Vmn2r107 UTSW 17 20374990 missense probably benign 0.01
R0667:Vmn2r107 UTSW 17 20355654 missense possibly damaging 0.91
R1118:Vmn2r107 UTSW 17 20356598 missense probably benign 0.03
R1204:Vmn2r107 UTSW 17 20357769 missense probably benign
R1237:Vmn2r107 UTSW 17 20356685 nonsense probably null
R1485:Vmn2r107 UTSW 17 20374847 missense possibly damaging 0.95
R1783:Vmn2r107 UTSW 17 20356513 missense possibly damaging 0.51
R1873:Vmn2r107 UTSW 17 20345578 missense probably benign 0.10
R1974:Vmn2r107 UTSW 17 20355617 splice site probably null
R2009:Vmn2r107 UTSW 17 20375467 missense probably benign 0.01
R2029:Vmn2r107 UTSW 17 20375287 missense probably benign 0.01
R2164:Vmn2r107 UTSW 17 20375642 missense probably damaging 1.00
R2269:Vmn2r107 UTSW 17 20375555 missense possibly damaging 0.58
R3087:Vmn2r107 UTSW 17 20360345 missense probably benign 0.03
R3740:Vmn2r107 UTSW 17 20374889 missense probably benign 0.00
R3961:Vmn2r107 UTSW 17 20375455 missense probably damaging 1.00
R4031:Vmn2r107 UTSW 17 20375221 missense probably benign 0.00
R4270:Vmn2r107 UTSW 17 20355779 missense probably benign
R4963:Vmn2r107 UTSW 17 20375141 missense probably damaging 1.00
R5121:Vmn2r107 UTSW 17 20355753 missense probably benign 0.01
R5640:Vmn2r107 UTSW 17 20375164 missense probably damaging 1.00
R6007:Vmn2r107 UTSW 17 20375054 missense probably benign 0.19
R6238:Vmn2r107 UTSW 17 20345587 missense probably benign 0.43
R6298:Vmn2r107 UTSW 17 20355782 missense probably benign 0.00
R6467:Vmn2r107 UTSW 17 20375677 missense probably damaging 0.99
R6726:Vmn2r107 UTSW 17 20375375 missense probably damaging 0.96
R7299:Vmn2r107 UTSW 17 20345616 missense probably benign 0.01
R7301:Vmn2r107 UTSW 17 20345616 missense probably benign 0.01
R7375:Vmn2r107 UTSW 17 20355876 missense probably benign
R7448:Vmn2r107 UTSW 17 20375732 missense probably benign 0.00
R7495:Vmn2r107 UTSW 17 20375009 missense possibly damaging 0.71
R7589:Vmn2r107 UTSW 17 20375372 missense probably benign 0.05
R7594:Vmn2r107 UTSW 17 20360373 missense probably benign 0.03
R7678:Vmn2r107 UTSW 17 20356639 missense probably benign 0.01
R7929:Vmn2r107 UTSW 17 20345444 missense probably null 0.96
R7974:Vmn2r107 UTSW 17 20357008 missense probably benign 0.00
R8040:Vmn2r107 UTSW 17 20375546 missense probably damaging 1.00
R8263:Vmn2r107 UTSW 17 20360352 missense probably damaging 1.00
R8426:Vmn2r107 UTSW 17 20356977 missense possibly damaging 0.91
X0022:Vmn2r107 UTSW 17 20356968 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TGGGTCATGAACATTGAACCC -3'
(R):5'- CCTGCCATGGAAAGAACTCC -3'

Sequencing Primer
(F):5'- TCATGTTAGATTCATTCCATGGAAG -3'
(R):5'- GGAAAGAACTCCATCCCTTCTTC -3'
Posted On2018-08-29