Incidental Mutation 'R6783:Ddx54'
ID531503
Institutional Source Beutler Lab
Gene Symbol Ddx54
Ensembl Gene ENSMUSG00000029599
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 54
Synonyms2410015A15Rik, APR-5, DP97
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6783 (G1)
Quality Score214.009
Status Validated
Chromosome5
Chromosomal Location120612739-120628592 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 120618714 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 163 (Q163*)
Ref Sequence ENSEMBL: ENSMUSP00000031598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031598]
Predicted Effect probably null
Transcript: ENSMUST00000031598
AA Change: Q163*
SMART Domains Protein: ENSMUSP00000031598
Gene: ENSMUSG00000029599
AA Change: Q163*

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Blast:DEXDc 59 101 9e-19 BLAST
DEXDc 114 313 3.5e-58 SMART
HELICc 347 432 7.86e-20 SMART
low complexity region 628 646 N/A INTRINSIC
DBP10CT 706 766 1.45e-25 SMART
low complexity region 778 801 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.8%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The nucleolar protein encoded by this gene interacts in a hormone-dependent manner with nuclear receptors, and represses their transcriptional activity. Alternative splice variants that encode different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik G A 8: 11,655,661 Q39* probably null Het
5430419D17Rik T C 7: 131,226,764 L316P probably damaging Het
Adam12 T A 7: 133,974,397 Q228L probably damaging Het
Arhgap45 A G 10: 80,017,864 T71A possibly damaging Het
Bag6 T A 17: 35,144,235 S684T possibly damaging Het
BC067074 A T 13: 113,320,209 K930* probably null Het
Bcam C T 7: 19,766,881 G123R probably damaging Het
Cdr2l C T 11: 115,393,669 A277V possibly damaging Het
Clcn4 T A 7: 7,299,182 probably benign Het
Csnk1g1 T A 9: 65,973,512 I72N probably damaging Het
Ddx31 G A 2: 28,874,176 V465I probably benign Het
Dnmt3a A G 12: 3,897,406 E459G probably damaging Het
Dpp8 T C 9: 65,063,562 S568P possibly damaging Het
Drap1 G T 19: 5,424,191 T47K probably damaging Het
Epha7 G T 4: 28,950,528 R777L possibly damaging Het
Far2 T G 6: 148,150,775 probably null Het
Fhdc1 T C 3: 84,445,527 K797R probably benign Het
Gm10330 A T 12: 23,780,093 M29K probably damaging Het
Gm17689 T A 9: 36,581,335 probably null Het
Gm5640 C T X: 74,640,415 R355H probably damaging Homo
Grik3 A T 4: 125,632,300 I109F probably benign Het
Il31ra T C 13: 112,551,988 probably null Het
Itga1 T G 13: 114,996,977 I466L probably benign Het
Itpr2 A T 6: 146,385,873 probably null Het
Mical3 A C 6: 120,958,825 L1580R possibly damaging Het
Olfr299 T A 7: 86,465,627 V72D probably damaging Het
Olfr732 T C 14: 50,282,187 D22G probably benign Het
Palb2 T A 7: 122,127,488 E386D probably damaging Het
Papd4 G A 13: 93,155,018 A368V probably benign Het
Papd4 C G 13: 93,155,019 A372P probably benign Het
Polm C A 11: 5,835,534 R175L probably damaging Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Ptcd3 A T 6: 71,908,643 V33D probably benign Het
Ripk4 C A 16: 97,748,037 R273L probably damaging Het
Rpap2 A G 5: 107,655,287 T612A probably damaging Het
Serpinb10 A G 1: 107,546,867 N253S possibly damaging Het
Sgpp1 G C 12: 75,735,469 P32R probably benign Het
Sim1 T C 10: 50,908,727 I156T possibly damaging Het
Ski A T 4: 155,160,832 probably null Het
Trdn C T 10: 33,438,815 R512C probably damaging Het
Trim33 T C 3: 103,352,087 Y1031H probably damaging Het
Use1 T C 8: 71,369,236 L188P probably damaging Het
Usp34 G A 11: 23,412,318 G1588D probably damaging Het
Vmn2r33 C A 7: 7,563,798 R105L probably benign Het
Vmn2r53 G A 7: 12,601,433 S100F probably damaging Het
Other mutations in Ddx54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Ddx54 APN 5 120623810 critical splice donor site probably null
IGL01324:Ddx54 APN 5 120623638 missense probably benign 0.00
IGL01399:Ddx54 APN 5 120623903 nonsense probably null
IGL02052:Ddx54 APN 5 120625718 missense possibly damaging 0.93
IGL02095:Ddx54 APN 5 120623791 missense possibly damaging 0.81
IGL02370:Ddx54 APN 5 120619787 missense probably damaging 1.00
IGL02861:Ddx54 APN 5 120618130 splice site probably benign
R0521:Ddx54 UTSW 5 120626862 missense probably benign 0.00
R0556:Ddx54 UTSW 5 120619654 splice site probably benign
R0723:Ddx54 UTSW 5 120623638 missense probably benign 0.00
R2968:Ddx54 UTSW 5 120618629 missense probably damaging 1.00
R4622:Ddx54 UTSW 5 120626423 missense probably damaging 1.00
R4853:Ddx54 UTSW 5 120623629 missense probably benign 0.12
R5168:Ddx54 UTSW 5 120617032 missense probably benign 0.00
R5169:Ddx54 UTSW 5 120623263 missense probably damaging 1.00
R5424:Ddx54 UTSW 5 120619861 critical splice donor site probably null
R5489:Ddx54 UTSW 5 120624721 missense probably benign
R5956:Ddx54 UTSW 5 120626367 unclassified probably benign
R5999:Ddx54 UTSW 5 120623580 missense probably benign 0.00
R6220:Ddx54 UTSW 5 120620689 missense probably benign 0.09
R6413:Ddx54 UTSW 5 120627062 missense probably benign
R6477:Ddx54 UTSW 5 120621778 missense probably damaging 1.00
R6702:Ddx54 UTSW 5 120626503 missense possibly damaging 0.52
R6865:Ddx54 UTSW 5 120621827 critical splice donor site probably null
R7258:Ddx54 UTSW 5 120620747 missense probably damaging 1.00
R7260:Ddx54 UTSW 5 120626920 missense probably benign 0.21
R7488:Ddx54 UTSW 5 120624724 missense probably benign
R7887:Ddx54 UTSW 5 120627203 missense probably damaging 1.00
R7970:Ddx54 UTSW 5 120627203 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGGAGTCAAGGATGCTTACTG -3'
(R):5'- TGAACTTGCCTAGCTGTGGAG -3'

Sequencing Primer
(F):5'- CAAGGATGCTTACTGGAGGTG -3'
(R):5'- CTTGCCTAGCTGTGGAGAGAGG -3'
Posted On2018-08-29