Mutagenetix > Incidental Mutations

Incidental Mutation 'R6783:Ddx54'

531503

Institutional Source

Beutler Lab

Gene Symbol

Ddx54

Ensembl Gene

ENSMUSG00000029599

Gene Name

DEAD (Asp-Glu-Ala-Asp) box polypeptide 54

Synonyms

2410015A15Rik, APR-5, DP97

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6783 (G1)

Quality Score

214.009

Status

Validated

Chromosome

Chromosomal Location

120612739-120628592 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 120618714 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 163 (Q163*)

Ref Sequence

ENSEMBL: ENSMUSP00000031598 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031598]

Predicted Effect

probably null
Transcript: ENSMUST00000031598
AA Change: Q163*

SMART Domains

Protein: ENSMUSP00000031598
Gene: ENSMUSG00000029599
AA Change: Q163*

Domain	Start	End	E-Value	Type
low complexity region	4	15	N/A	INTRINSIC
Blast:DEXDc	59	101	9e-19	BLAST
DEXDc	114	313	3.5e-58	SMART
HELICc	347	432	7.86e-20	SMART
low complexity region	628	646	N/A	INTRINSIC
DBP10CT	706	766	1.45e-25	SMART
low complexity region	778	801	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.8%

Validation Efficiency

95% (42/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The nucleolar protein encoded by this gene interacts in a hormone-dependent manner with nuclear receptors, and represses their transcriptional activity. Alternative splice variants that encode different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016D06Rik	G	A	8: 11,655,661	Q39*	probably null	Het
5430419D17Rik	T	C	7: 131,226,764	L316P	probably damaging	Het
Adam12	T	A	7: 133,974,397	Q228L	probably damaging	Het
Arhgap45	A	G	10: 80,017,864	T71A	possibly damaging	Het
Bag6	T	A	17: 35,144,235	S684T	possibly damaging	Het
BC067074	A	T	13: 113,320,209	K930*	probably null	Het
Bcam	C	T	7: 19,766,881	G123R	probably damaging	Het
Cdr2l	C	T	11: 115,393,669	A277V	possibly damaging	Het
Clcn4	T	A	7: 7,299,182		probably benign	Het
Csnk1g1	T	A	9: 65,973,512	I72N	probably damaging	Het
Ddx31	G	A	2: 28,874,176	V465I	probably benign	Het
Dnmt3a	A	G	12: 3,897,406	E459G	probably damaging	Het
Dpp8	T	C	9: 65,063,562	S568P	possibly damaging	Het
Drap1	G	T	19: 5,424,191	T47K	probably damaging	Het
Epha7	G	T	4: 28,950,528	R777L	possibly damaging	Het
Far2	T	G	6: 148,150,775		probably null	Het
Fhdc1	T	C	3: 84,445,527	K797R	probably benign	Het
Gm10330	A	T	12: 23,780,093	M29K	probably damaging	Het
Gm17689	T	A	9: 36,581,335		probably null	Het
Gm5640	C	T	X: 74,640,415	R355H	probably damaging	Homo
Grik3	A	T	4: 125,632,300	I109F	probably benign	Het
Il31ra	T	C	13: 112,551,988		probably null	Het
Itga1	T	G	13: 114,996,977	I466L	probably benign	Het
Itpr2	A	T	6: 146,385,873		probably null	Het
Mical3	A	C	6: 120,958,825	L1580R	possibly damaging	Het
Olfr299	T	A	7: 86,465,627	V72D	probably damaging	Het
Olfr732	T	C	14: 50,282,187	D22G	probably benign	Het
Palb2	T	A	7: 122,127,488	E386D	probably damaging	Het
Papd4	G	A	13: 93,155,018	A368V	probably benign	Het
Papd4	C	G	13: 93,155,019	A372P	probably benign	Het
Polm	C	A	11: 5,835,534	R175L	probably damaging	Het
Prpf40b	C	T	15: 99,314,903	R627W	probably damaging	Het
Ptcd3	A	T	6: 71,908,643	V33D	probably benign	Het
Ripk4	C	A	16: 97,748,037	R273L	probably damaging	Het
Rpap2	A	G	5: 107,655,287	T612A	probably damaging	Het
Serpinb10	A	G	1: 107,546,867	N253S	possibly damaging	Het
Sgpp1	G	C	12: 75,735,469	P32R	probably benign	Het
Sim1	T	C	10: 50,908,727	I156T	possibly damaging	Het
Ski	A	T	4: 155,160,832		probably null	Het
Trdn	C	T	10: 33,438,815	R512C	probably damaging	Het
Trim33	T	C	3: 103,352,087	Y1031H	probably damaging	Het
Use1	T	C	8: 71,369,236	L188P	probably damaging	Het
Usp34	G	A	11: 23,412,318	G1588D	probably damaging	Het
Vmn2r33	C	A	7: 7,563,798	R105L	probably benign	Het
Vmn2r53	G	A	7: 12,601,433	S100F	probably damaging	Het

Other mutations in Ddx54

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Ddx54	APN	5	120623810	critical splice donor site	probably null
IGL01324:Ddx54	APN	5	120623638	missense	probably benign	0.00
IGL01399:Ddx54	APN	5	120623903	nonsense	probably null
IGL02052:Ddx54	APN	5	120625718	missense	possibly damaging	0.93
IGL02095:Ddx54	APN	5	120623791	missense	possibly damaging	0.81
IGL02370:Ddx54	APN	5	120619787	missense	probably damaging	1.00
IGL02861:Ddx54	APN	5	120618130	splice site	probably benign
R0521:Ddx54	UTSW	5	120626862	missense	probably benign	0.00
R0556:Ddx54	UTSW	5	120619654	splice site	probably benign
R0723:Ddx54	UTSW	5	120623638	missense	probably benign	0.00
R2968:Ddx54	UTSW	5	120618629	missense	probably damaging	1.00
R4622:Ddx54	UTSW	5	120626423	missense	probably damaging	1.00
R4853:Ddx54	UTSW	5	120623629	missense	probably benign	0.12
R5168:Ddx54	UTSW	5	120617032	missense	probably benign	0.00
R5169:Ddx54	UTSW	5	120623263	missense	probably damaging	1.00
R5424:Ddx54	UTSW	5	120619861	critical splice donor site	probably null
R5489:Ddx54	UTSW	5	120624721	missense	probably benign
R5956:Ddx54	UTSW	5	120626367	unclassified	probably benign
R5999:Ddx54	UTSW	5	120623580	missense	probably benign	0.00
R6220:Ddx54	UTSW	5	120620689	missense	probably benign	0.09
R6413:Ddx54	UTSW	5	120627062	missense	probably benign
R6477:Ddx54	UTSW	5	120621778	missense	probably damaging	1.00
R6702:Ddx54	UTSW	5	120626503	missense	possibly damaging	0.52
R6865:Ddx54	UTSW	5	120621827	critical splice donor site	probably null
R7258:Ddx54	UTSW	5	120620747	missense	probably damaging	1.00
R7260:Ddx54	UTSW	5	120626920	missense	probably benign	0.21
R7488:Ddx54	UTSW	5	120624724	missense	probably benign
R7887:Ddx54	UTSW	5	120627203	missense	probably damaging	1.00
R7970:Ddx54	UTSW	5	120627203	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAAGGAGTCAAGGATGCTTACTG -3'
(R):5'- TGAACTTGCCTAGCTGTGGAG -3'

Sequencing Primer
(F):5'- CAAGGATGCTTACTGGAGGTG -3'
(R):5'- CTTGCCTAGCTGTGGAGAGAGG -3'

Posted On

2018-08-29